SGN Marker cLEX-2-F13

SGN-M3111

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C94063
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51108)
Chromosome
6
Position
44.00 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49044)
Chromosome
6
Position
91.09 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40440)
Chromosome
6
Position
85.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEX-2-F13 was used as an overgo probe on plate 2 [well G12]

Plausible BAC Matches:   P169C11,   P169D11

 Overgo Sequences

A sequence
CCGCAGAGGACAAAATGTTGGAAC
B sequence
CCCTGAACAAGACGTAGTTCCAAC
AB sequence
CCGCAGAGGACAAAATGTTGGAACTACGTC
Marker sequence
GCTCTGACTTCCCTCCTTCCCCATTTCAAAACCCTAACCCTAGTTTCCCG
CAGAGGACAAAATGTTGGAACTACGTCTTGTTCAGGGAAGTCTGCTGAAG
AAAGTTCTAGAATCGATTAAGGATCTGGTGAACGATGCGAACTTTGATTG
TTCCGCCACTGGATTCTCTCTGCAAGCCATGGACTCCAGTCACGTGGCTC
TGGTGGCGCTGCTGCTCCGATCTGAGGGTTTTGAGCACTATCGTTGTGAC
CGGAACATTTCAATGGGCATGAACCTTACTAACATGGCGAAAATGCTCAA
ATGTGCTGGAAATGATGACATCATCACCATCAAGGCTGACGATGGCAGTG
ACACCGTCACTTTCATGTTAGAAAGCCCCACCCAAGACATGATT
Genomic location of cLEX-2-F13  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3111 marker 3111
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)