SGN Marker cLES-1-K3

SGN-M3112

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C77072
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51080)
Chromosome
6
Position
44.24 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49016)
Chromosome
6
Position
96.51 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40354)
Chromosome
6
Position
90.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLES-1-K3 was used as an overgo probe on plate 3 [well E3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAAGCCCACAGCTAATTTCAGCCA
B sequence
AGTGACCCACAATTGCTGGCTGAA
AB sequence
CAAGCCCACAGCTAATTTCAGCCAGCAATT
Marker sequence
GGAATATCGAAATGCATATAACTGAATTGATCTAATCATCCCATTCCAAT
GGTTTATAACAACTGGCCATAAAATAAAAAACTAAAATATACGAAGGAGC
ATATTCCCAGAGAGTATGACATGCTCTGATCCAAGAACAAGATAAAGACA
TTCTAAAACTTACAACCATCATCACTCAGAACGATTGGCATACCTCTCCA
CCTTTTCATCAAGATTGATTCCAACCATAGCCTCACCAAGCCCACAGCTA
ATTTCAGCCAGCAATTGTGGGTCACTGTAATGAGTCACTGCTTGCACGAT
GGCACGTCCCCTCTTTGCAGGGTCACCACTCTTGAAGATACCAGAACCCA
CGAACACGCCGTCACATCCCAACTGGATCATAAGCGCTGCATCTGCTGGT
GTCGCCACCCCACCTGCTGCAAAGTGAACCACAGGGAGCCTACCAAGTTG
CTTTGTTTGCATCACCAGATCGTATGGTGCCTGAATCTT
Genomic location of cLES-1-K3  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3112 marker 3112
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)