SGN Marker T1940

SGN-M3117
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39797)
Chromosome
7
Position
2.30 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1940 was used as an overgo probe on plate 7 [well H4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAGGTTGAAGTGAAGCTCAGGTTG
B sequence
GTGCTGATGAATCAGGCAACCTGA
AB sequence
GAGGTTGAAGTGAAGCTCAGGTTGCCTGAT
Marker sequence
GAGAAATGCTGAGAAGAAAGCCCAGCAAAATCGAAGTAAAAATCGAAGAC
AAAGAAGAACTCGAAGAAGCTCGCAAACGCGCCGCCCTCATCGCCGCCTC
TTCCTCCACCAGTACCGCCGCCGGTACCGGCGGAGCTGCCACAGCCGGTG
TCTCCTCTCTCCTCCAACACTTCGACCGATCAACAGTCGATCCTTCCTCC
AAAAACAACCGCATCGGCCTCAATTAATGGAGGTTGAAGTGAAGCTCAGG
TTGCCTGATTCATCAGCACATCAGAAGGTACTCTCACTTTTCTCATCGCA
CCACAAAAAAACACACCACCAGCGTAACACTTTCTTCGATGGCGCTGCCG
GCGAGTTGAGCTCGCGCCGGGCTGTTCTCCGGCTTCGATTCTATGAGAAC
TCGGAGAAAGTGAAATGCATGGTGTGTCTCAAGGCTAAAGCTGTAATTAT
CGACGGTGTTAGTCGAGTGGAAGAGGATGAAGAGGAATTAGATCCGAAAA
TTGGATATGAATGCGTTTCTAACCCTAGAAAACTGATGGAGGTAGATTCT
AAGGTTTTGAAAAGGGCAAGAGAGGAATTT
Genomic location of T1940  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3117 marker 3117
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)