SGN Marker T1936

SGN-M3118
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39795)
Chromosome
7
Position
2.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1936 was used as an overgo probe on plate 7 [well G5]

Plausible BAC Matches:   P016P08,   P333I23,   P193E01

 Overgo Sequences

A sequence
CCCAGTAGCTGTATACACTTCAGG
B sequence
AGCTGAAGATCCCTTGCCTGAAGT
AB sequence
CCCAGTAGCTGTATACACTTCAGGCAAGGG
Marker sequence
AGGGTTGCTCCCTCAATATTTGGGCATGTTGATGTCAAAAAAGCTGTCGC
ATGTCTTTTATTTGGAGGGTCAAGGAAGTTCTTGCCTGATGGTGTAAGAT
TAAGAGGTGATATCAACGTATTGCTCTTGGGGGATCCCTCGACTGCTAAA
TCACAGTTTCTAAAATTTGTGGAAAAAACAGCCCCAGTAGCTGTATACAC
TTCAGGCAAGGGATCTTCAGCTGCTGGTCTCACAGCTTCTGTAATTAGGG
ATAATAGCTCTCGTGAGTTTTACCTAGAAGGTGGAGCCATGGTCTTGGCA
GATGGAGGAGTTGTCTGCATTGATGAGTTTGACAAAATGAGGCCAGAAGA
TAGAGTGGCTATTCATGAAGCAATGGAACAGCAAACGATTTCCATTGCGA
AGGCTGGAATTACAACAGTCCTTAATTCAAGAACAGCGGNGCTTGCTGCT
GCTAATCCTCCATCTGGACGCTATGATGATCTCAAGACTGCACAAGATAA
CATTGACTTGCAGACAACAATTCTTTCAAGATTCGATTTGATTTTCATTG
TGAAAGACATCAGGAAGTACGATCAGGACAAGCGTATTGCTAGCCATATT
GTCAGGGTCCATGCATCTGCTGAAGCATCTAGGGATGACACG
Genomic location of T1936  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3118 marker 3118
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)