SGN Marker TG16

SGN-M312

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1900
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CTCATGACCTAGTTTTCTGGAATTTGTTCGGGCGACCACCAAAATCATTACCCCTTCCACGCGAATGCTTCCCACCTCTGTTGAACCTTC
CTCCCCTATGTTCATGAACAACAACATTAGGATCAAGCAAGGGATAACAAGTTCTCAGTTGTGGCTCTACATCACTCATTCAAGTGGGGA
ATCTCACATCATAATAGAATATCTCAACAATCATTGATGCATGCACTTTCATCTTTTAGATTTAGTTTTGTGGGTACTTGAGCTTGACTT
ACTATACTAAGCACCAAAACACTGGACCTCATAACCTAATATGTGCTTTGAACGAACCCAAAAACTACAACAGCGACCAAGTAACATGTA
TTTATGGCTATCTTATTTCACTAACTCGCATATTAGAGGGATCATGTAACTTAACATGTTTATTGAGAAAGAATGTAGCAGAATAACATT
ATGACAGCTAAGGCTTACCTTCCCCTATTCCCTTTAAAGTCACGGCGTTTTTCCTGCTGGCCATTACGGAACATAG
Reverse sequence
CTCATGACCTAGTTTTCTGGAATTTGTTCGGGCGTCCACCAAAATCATTACCCCTTCCACGCGAATGCTTCCCACCTCTGTTGAACCTTC
CTCCCCTATGTTCATGAACAACAACATTAGTATCAAGCAAGGGATAACAAGTTCTCAGTTGTGGCTCTACATCACTCATTCAAGTGGGGA
ATCTCACATCATAATAGAATATCTCAACAATCATTGATGCATGCACTTTCATCTTTTAGTTTTAGTTTTGTGGGTACTTGAGCTTGACTT
ACTATACTAAGCACCAAAACACTGGACCTCATAACCTAATATGTGCTTTGAACGAACCCAGAAACTACAACAGCGACCAAGTAACATGTA
TTTATGGTTATCTTATTTCACTAACTCGCATATTAGAGGGATCATGTAACTTAACATGTTTATTGAGAAAGAATGTAGCAGAATAACATT
ATGACAGCTAAGGCTTACCTTCCCCTATTCCCTTTAAAGTCACGGCGTTTTTCCTGCTGGCCATTACGGAACATAGTCCAG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1689363.6e-3997 (18.4% of RFLP seq)+
SGN-U1689361.5e-4197 (18.3% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53194)
Chromosome
8
Position
84.34 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53195)
Chromosome
9
Position
55.69 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53196)
Chromosome
9
Position
60.54 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8862)
Chromosome
8
Position
34.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8863)
Chromosome
8
Position
17.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Potato-TXB 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8864)
Chromosome
9
Position
19.70 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG16 was used as an overgo probe on plate 12 [well H3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TTAAAGTCACGGCGTTTTTCCTGC
B sequence
TGTTCCGTAATGGCCAGCAGGAAA
AB sequence
TTAAAGTCACGGCGTTTTTCCTGCTGGCCA
Marker sequence
CTCATGACCTAGTTTTCTGGAATTTGTTCGGGCGACCACCAAAATCATTA
CCCCTTCCACGCGAATGCTTCCCACCTCTGTTGAACCTTCCTCCCCTATG
TTCATGAACAACAACATTAGGATCAAGCAAGGGATAACAAGTTCTCAGTT
GTGGCTCTACATCACTCATTCAAGTGGGGAATCTCACATCATAATAGAAT
ATCTCAACAATCATTGATGCATGCACTTTCATCTTTTAGATTTAGTTTTG
TGGGTACTTGAGCTTGACTTACTATACTAAGCACCAAAACACTGGACCTC
ATAACCTAATATGTGCTTTGAACGAACCCAAAAACTACAACAGCGACCAA
GTAACATGTATTTATGGCTATCTTATTTCACTAACTCGCATATTAGAGGG
ATCATGTAACTTAACATGTTTATTGAGAAAGAATGTAGCAGAATAACATT
ATGACAGCTAAGGCTTACCTTCCCCTATTCCCTTTAAAGTCACGGCGTTT
TTCCTGCTGGCCATTACGGAACATAG
Genomic location of TG16  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D312 marker 312
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)