SGN Marker cLPT-4-H11

SGN-M3123

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C110333
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40468)
Chromosome
7
Position
21.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-4-H11 was used as an overgo probe on plate 7 [well E11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CACTTCCAAGTGTTGGAAGGTACC
B sequence
TCGACCAAGGCAAGAAGGTACCTT
AB sequence
CACTTCCAAGTGTTGGAAGGTACCTTCTTG
Marker sequence
GCTTGTTCGTTTTAGCCCTTCTAGTATTCAACGAGTCATGGAAAAACTTT
CATTCAAGGATATGGTTTCAAGCCTGGTGAAGCGTAATCCACGAGAGCAA
CAAATCTGCTTAAACATTCTGAACATGACTCTCCTAGAAAGTCATACACT
TCCAAGTGTTGGAAGGTACCTTCTTGCCTTGGTCGAAGACAAGAATCTTG
TTCTGAATCTTGTGACTCTAATTGAGCAGGGAAGTGAAGTTTTGAAGGGA
AAGGCACTCATATTTGTGGCTCTACTTTGTACGAATGGGAAGAGGTGGCT
GCCACTATTTTTTTGCAATGCTAAACTGCTCTCAACCGTTGATAGGTTGG
TTAAGGAGAAGGATGACTTTGTGAAGCAGTGTTTAGATGCACTTGGGATG
GTTGTCACATCAACTGTACCAAGTTTGCTTGAATGTATATCTGGGGACAT
TCAGCAACTGAAGGGTGGTAAACGCCGTGGGCAGATAATTAGTGTCACAA
GTCGAAATTCTTCTAAGAACAGTATGCATTTATTTCCTGTTGTTCTCCAT
CTTCTTGGGTGCGCTTCACTGAAAAGAAAGGTTGCTAATTATCAGGTTCT
GCAACAGTTGGCAAATCTACTTAAACTGGTGGAGTCTCCTTTCCAGGGTA
GAGATGATTTTCAGATAACACTTTTACGTGTTCTTGAGTCTATA
Genomic location of cLPT-4-H11  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3123 marker 3123
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)