SGN Marker cTOB-5-H2

SGN-M3125

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C122715
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40498)
Chromosome
7
Position
22.30 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cTOB-5-H2 was used as an overgo probe on plate 8 [well A10]

Plausible BAC Matches:   P248N04,   P028N20,   P197C03,   P188A19,   P275O07,   P121O22,   P034B22,   P310F01,   P248C20,   P024C03,   P023P06,   P130N22

 Overgo Sequences

A sequence
AAGGAGCCTCGTTCAAATCCACTG
B sequence
GATGCACAGAGGACAACAGTGGAT
AB sequence
AAGGAGCCTCGTTCAAATCCACTGTTGTCC
Marker sequence
AATAATGAAATTTTATCTTTTTTTCACAATACAAGTTTATGGTACATGTG
TTTTGTATGCATCAAATGATGAAAAAGAAAGAGAGTCCTGTGTTTCTTCC
TCATATGTCCTAATACAAAATCTATTTCCTAAATGGGAGATTATTGGGCT
TATCTACTCCCTTAGATGTAGAGGAACAAGATGAGGACATGTTAGTCTTA
GCAAATTCTTCTTTATCCTCCGTGAATGCTTTAGACAAAATTTCTTGAAG
TTCCATGTACCTTTGCTTCTTCAGTTGACGCTCTTCTACTGTATCATTCC
CCATGTAAGCTATCTCAGACAAGTCATCAGCATCCATGATCTTATTTAGA
ACTTCTGAACAACGTGGAAAGAACCGTTTTCCAAGTTCCACAGTTCTAGA
GAGAGCCCTAAGCCGATTCAAGTGCTCCTCTTTCATCTTGAAAGGAGCCT
CGTTCAAATCCACTGTTGTCCTCTGTGCATCAGCTATCTTCTTCCTCATG
CTAGCCAGGGGTAATT
Genomic location of cTOB-5-H2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3125 marker 3125
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)