SGN Marker T1974

SGN-M3128
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39815)
Chromosome
7
Position
23.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1974 was used as an overgo probe on plate 8 [well G3]

Plausible BAC Matches:   P261E14,   P101F11,   P314J20,   P061A04,   P041L08,   P326F13,   P269G13,   P019P04,   P058J10,   P254B22

 Overgo Sequences

A sequence
ACCTGGACTCACTAAGGCATATCC
B sequence
TCGAGCGGGAGTAATTGGATATGC
AB sequence
ACCTGGACTCACTAAGGCATATCCAATTAC
Marker sequence
TATCAGTGTAGACATGAGGAGTTAACAACCATTACACAAGAATTTCACTC
ATTTTCCTCCTCCAATTGCTACTGTCAATTCAAAAAAGCTTAGCTTGAGG
GAACAGAAATGGTGTCGTACATGAGCTTGTTGCTGTACGGAGTGGGAGGA
ATAGTGGTCGCCGGGATGGCAATACTGGTCGCCTTTCAGGAAAAACTTGT
ATATGTTCCCGTCTTACCTGGACTCACTAAGGCATATCCAATTACTCCCG
CTCGACTTCGACTCCTTTACGAAGATGTTTGGCTCAGATCTTCAGACGGT
GTTCGTCTTCATGCTTGGTTCATCAAACTCTTCCCTGACTGCAGAGGTCC
TACTATCATCTTTTTTCAAGAGAATGCAGGAAATATTGCACATCGTCTTG
AAATGGTTCGCATAATGTTACAACGTTTGCAATGCAATGTTTTTATGCTT
TCTTATCGAGGTTACGGAGCCAGTGATGGATACCCTTCTCAACATGGAAT
CACAAAGGATGCTCANGCTGCACTGGATCATTTAGTTCAGAGGACCGATA
TTGACACATCAAGAATAGTAGTCTTTGGAAGGTCACTTGGAGGAAGCTGT
GGCACTGTTCTTACCAAAAACAATCCTGACAAGGTAGCTGGGCTCATTTT
GGAGAATA
Genomic location of T1974  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3128 marker 3128
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)