Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker FW7

SGN-M3129

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39093)
Chromosome
7
Position
24.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 13957
Forward primer (5'-3')
ACAGCCAGACCCTTCTCATACT
Digested band sizes (using MspI)
Solanum pennellii LA716: 750
Solanum lycopersicum LA925: 700
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GGATCCTAAAAGAATGTGCAGT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13957
Forward primer (5'-3')
ACAGCCAGACCCTTCTCATACT
Digested band sizes (using MspI)
Solanum pennellii LA716: 750
Solanum lycopersicum LA925: 700
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GGATCCTAAAAGAATGTGCAGT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 89
Forward primer (5'-3')
Unknown
Digested band sizes (using MspI)
Solanum lycopersicum LA925: 700
Solanum pennellii LA716: 750
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of FW7  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3129 marker 3129
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)