SGN Marker cLED-22-K8

SGN-M3131

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C18270
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51072)
Chromosome
7
Position
53.87 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49008)
Chromosome
7
Position
32.66 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40305)
Chromosome
7
Position
30.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLED-22-K8 was used as an overgo probe on plate 9 [well A3]

Plausible BAC Matches:   P174O13,   P123I21,   P097F22,   P033J18,   P003O21,   P022M07,   P124C11,   P142D02,   P061F11,   P297D15,   P036O23,   P033N20,   P330N15,   P232J14,   P264C05,   P309G22,   P049O14,   P256H18,   P236D20,   P309K07,   P287L08,   P324M14,   P061A09,   P046L09,   P298L15,   P037I08

 Non-Plausible BAC matches

P284H17,   P012K20,   P002D12,   P329E17,   P236D19,   P076G01,   P266F09

 Overgo Sequences

A sequence
AACCTCCACATGTACCAAGACCTC
B sequence
GGAGGATGCACTATAGGAGGTCTT
AB sequence
AACCTCCACATGTACCAAGACCTCCTATAG
Marker sequence
GCACCAGCCATGCCCTCCTCCATCTCATCATGGTCCTAAGCCACCAATTG
TAAAACCTCCACATGTACCAAGACCTCCTATAGTGCATCCTCCTCCCATT
GTCTCTCCACCTTCCACACCTAAACCACCAAAAACACCACCATTCACTCC
AAAACCACCATCACCAATACCACCTATTGTTTCACCCCCTATTGTTTATC
CACCAATCACTCCAACACCACCTATTGTCCATCCACCAGTCACTCCAAAA
CCACCATCACCAACACCTCCTATTGTTTCACCCCCCATTGTTTATCCACC
AATCACTCCAACACCACCTGTTGTGTCACCTCCAATCATTCCAACACCAC
CTATTGTCTCTCCACCTTTTGTCCCCAATCCTCCCGTGGTAATACCACCA
CCCTACGTGCCAAGTCCTCCGGTTGTTACTCCACCCATAGTTCCAACACC
CCCTACACCATGCCCACCACCACCACCACCACCAGCAATAATACCATCAC
CACCAGCACAACCAA
Genomic location of cLED-22-K8  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3131 marker 3131
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)