SGN Marker CD40

SGN-M3142

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53435)
Chromosome
8
Position
17.44 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51716)
Chromosome
8
Position
101.55 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47251)
Chromosome
8
Position
11.41 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42943)
Chromosome
8
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43943
Forward primer (5'-3')
TCAAAAGGACAACAACCAATAAGC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GATGAGGCTGCGGAGTTATTCG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38937)
Chromosome
8
Position
9.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 12829)
Chromosome
8
Position
13.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 12830)
Chromosome
8
Position
6.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 12834)
Chromosome
8
Position
20.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Genomic location of CD40  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3142 marker 3142
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)