SGN Marker cLET-3-O9

SGN-M3146

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C85696
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51101)
Chromosome
8
Position
43.96 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49037)
Chromosome
8
Position
26.33 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40387)
Chromosome
8
Position
20.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-3-O9 was used as an overgo probe on plate 12 [well G2]

Plausible BAC Matches:   P027D09,   P148A08

 Overgo Sequences

A sequence
TGGGACTCAAAGGAAGAGAGGAAG
B sequence
TTTGTCAGCTGGGCTTCTTCCTCT
AB sequence
TGGGACTCAAAGGAAGAGAGGAAGAAGCCC
Marker sequence
GCGAGAGATCATCTAGTTCAGCTCTACATCATGAACTCAAAGAATGTATG
GAGAGTGATGATGAGATCAGAAGAGTGCCGGAGATGGGCGGAGAAGCGAC
GGGGACAACGTCAGCTTCTGGAAGAGATGGAGTATCGGCCGCCGGTCAAG
CTCAACCATCAGCTGGGACTCAAAGGAAGAGAGGAAGAAGCCCAGCTGAC
AAAGAAAACAAAAGGTTAAAAAGATTGTTGAGAAATAGAGTATCAGCACA
ACAAGCAAGGGAGAGGAAGAAAGCATATTTGATAGATCTGGAAGCAAGGG
TGAAGGAATTGGCAACAAAGAATGCAGAACTTGAAGAGAGGTTGTCTACT
TTGCAAAATGAGAACCAAATGCTTAGACATATACTGAAGAACACAACAGC
AGGTGCACAGGAAGGGAGGAAGTGGACATATGATCGATCTTATGTCGATA
TGTCAGCATTCTTGTTTAGATCCTATGTA
Genomic location of cLET-3-O9  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3146 marker 3146
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)