SGN Marker cLER-5-P17

SGN-M3147

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C73756
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40350)
Chromosome
8
Position
23.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLER-5-P17 was used as an overgo probe on plate 13 [well E5]

Plausible BAC Matches:   P069E09,   P145P09

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CTGCGGCTATTATTGGCCAAGATG
B sequence
TGAGCCCAAACAGTTCCATCTTGG
AB sequence
CTGCGGCTATTATTGGCCAAGATGGAACTG
Marker sequence
TTGAGAGCTACTCTGAAGAAGAAGAAGAAACTAGGGTTGAATCAAAGATG
TCTTGGCAAACATATGTTGATGAACACTTGCTTTGTGAGAATGAAGGTAA
TCATCTCACTTCTGCGGCTATTATTGGCCAAGATGGAACTGTTTGGGCTC
AATCTGCCAATTTTCCTCAGTTCAAGCCCGAAGAAATAACAGGCATCATG
AATGACTTCGCGGTACCTGGAACACTTGCTCCAACTGGTTTGTATCTTGG
GGGAACAAAATACATGGTGATTCAAGGAGAGCCAGAAGCTGTGATCCGAG
GGAAGAAGGGTCCAGGTGGTATCACCATTAAGAAGACCAATCAGGCTTTG
ATCATTGGAATATATGATGAGCCGATGACTCCTGGACAGTGCAATATGAT
TGTTGAAAGGTTGGGTGACTATCTTATAGAACAGAGTCTCTAGGCATAAT
TGTGTATTACTGTCATCCTTACATAGTTGTGGCCGNTAACAAGTTATCAT
G
Genomic location of cLER-5-P17  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3147 marker 3147
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)