SGN Marker TG468

SGN-M315

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG468 image not available
Forward sequence
CTTTTGAACTTTGCTAGCCATTTTATATAATTAAGCGGGATGGTTTTGAGTTTTACTTATTTTGTAGTTAAATGACTGAAGTTCTTGTCC
TTTTTTTTTTGTCTTTGCCTGAAATTACTGAATTATTTTAATATTCCATGCGGAAGAATGTGCAAATTGCAAACAAAGATACATGCATGT
GACTTGCCAATGCAACGAGGGACTTGATATATGTGAATTTCTGTTTGTGTTACTTGTCCTTTTCAAATTTGGATTTTACAGTCTGATCTG
GATTTACGTTTAAAGAATTACGGTTCAGCTTATAACTGTTCACACTAGCCCTATACGTTGTTGCTGAACCATTTTGTGTCTCTATTGCTG
AGCAGTGAAATGCACAACTTGCGGACTGAAAATTTGAGGCAGCAGTATCACTTGGTAAGTACTTTTGGACATTGAGAATTAGGTTATCTA
GCTGATGTGGTAGTTAGAAAGTAAAATGATAACAAAATAAGGAATTTA
Reverse sequence
TAGGGAGACAAGCTTGCATGCCTGCAGATATGATAGAAGTTGCAAAAAGACAATTGTCAAACTACGATGATGAACCAAATCTTAACAATT
AAGAGTTCTATGAGGTGCTTACAAAAGATTTAAGGCAGGCCCAATCATCAACAAGAGGCTGACCCGCAGATCGAACATGCTTCAGCACCT
CAGGACCTTTTTGAATTCCAAACAGAAGCTTACCAACAAGGGCAATGCGTTCATCTAGGTGCATTCTGTGTGACATAGCTTCAGTGAATT
GTTTCTGAGCTTCAACTTTCCGAGCAGAGCCTTCAGGAGCCTTGCGGAACTGCCAGCATTGAGGAAGAATAGAAAATCAATAAGAAGGCA
TTTCACATCAGAGGCACAAGCCAATTAATACATAAACACATAAAGACCCACGAATTACAACATGTGGCTTACTAAAAATAACTCTTGCAG
CTTAGCACAAGTTACCCGCCTGTTTAGCATTGCTACCATTCATAAATGTAATGTTAGTGTCTTTTTGGAAACCAGCTATACCACATT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1454412.2e-0654 (10.8% of RFLP seq)+
SGN-U1451014.4e-2354 (10.8% of RFLP seq)+
SGN-U1613764.4e-2354 (10.8% of RFLP seq)+
SGN-U1454413.3e-30214 (39.9% of RFLP seq)-
SGN-U1613761.7e-50100 (18.6% of RFLP seq)-
SGN-U1451012e-118214 (39.9% of RFLP seq)-
SGN-U145102430 (80.1% of RFLP seq)-
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132220)
Chromosome
5
Position
84.08 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Eggplant-COSII   
Map version
63 (location: 42468)
Chromosome
5
Position
102.60 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40053)
Chromosome
12
Position
85.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8872)
Chromosome
5
Position
103.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8871)
Chromosome
12
Position
70.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG468 was used as an overgo probe on plate 16 [well A12]

Plausible BAC Matches:   P326K10

 Overgo Sequences

A sequence
CTCTATTGCTGAGCAGTGAAATGC
B sequence
TCAGTCCGCAAGTTGTGCATTTCA
AB sequence
CTCTATTGCTGAGCAGTGAAATGCACAACT
Marker sequence
CTTTTGAACTTTGCTAGCCATTTTATATAATTAAGCGGGATGGTTTTGAG
TTTTACTTATTTTGTAGTTAAATGACTGAAGTTCTTGTCCTTTTTTTTTT
GTCTTTGCCTGAAATTACTGAATTATTTTAATATTCCATGCGGAAGAATG
TGCAAATTGCAAACAAAGATACATGCATGTGACTTGCCAATGCAACGAGG
GACTTGATATATGTGAATTTCTGTTTGTGTTACTTGTCCTTTTCAAATTT
GGATTTTACAGTCTGATCTGGATTTACGTTTAAAGAATTACGGTTCAGCT
TATAACTGTTCACACTAGCCCTATACGTTGTTGCTGAACCATTTTGTGTC
TCTATTGCTGAGCAGTGAAATGCACAACTTGCGGACTGAAAATTTGAGGC
AGCAGTATCACTTGGTAAGTACTTTTGGACATTGAGAATTAGGTTATCTA
GCTGATGTGGTAGTTAGAAAGTAAAATGATAACAAAATAAGGAATTTA
Genomic location of TG468  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D315 marker 315
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)