SGN Marker cLET-3-N23

SGN-M3150

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C85683
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40386)
Chromosome
8
Position
35.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-3-N23 was used as an overgo probe on plate 12 [well A12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCTCCAGAATCAGATGGAAGGAAC
B sequence
GGCGCCTTCCAAATATGTTCCTTC
AB sequence
CCTCCAGAATCAGATGGAAGGAACATATTT
Marker sequence
AGCTTTGCTCTTGGTATGCCTTTCTCTAACAGAGTTTGGACTCCTCCAGA
ATCAGATGGAAGGAACATATTTGGAAGGCGCCAGACGCAAGAAAGAGTCT
TGCCTTCTGTTTCTGATGATTGTGAAACCAAAAACAGTCAGAAGGAGGAG
ATGATGGGAGAGTTTAACAAAGCACAAGTAGCTATCCAATCGTTGGATGA
TTCAATTGCTAAGATTCAAAGTGAGCTGCCTTCAACTAAGGATCCTCTAA
TTCCACGGATAACTGAAGAGGTTCCTTCCTTGAGGACAGATTCTGGAGGA
AGTGGAACGAGAAAGAAGACATTTATGGTTATTGGGATAAACACGGCCTT
CAGTAGTAGAAAAAGGCGCGATTCTATTAGAGAGACTTGGATGCCTCAAG
GTACAAAGCTACATAGATTAGAGCAAGAAAAGGGGATAATTGTGCGTTTC
ATGATAGGCCACAGCGCGATATCGGATAGCATTTTAGATCGAGCCATTGA
TAGTGAAGATGCTCAGCATAATGACATTCTTCGACTTGATCACGTAGAAA
GCTATCATGAGTTAACTGC
Genomic location of cLET-3-N23  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3150 marker 3150
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)