SGN Marker cLET-8-E2

SGN-M3151

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C88451
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40419)
Chromosome
8
Position
38.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-8-E2 was used as an overgo probe on plate 12 [well C10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAGGTAGCCTAGATGAAGTTCTGC
B sequence
TGCTCAGATCTCTCGTGCAGAACT
AB sequence
GAGGTAGCCTAGATGAAGTTCTGCACGAGA
Marker sequence
GAAATTCTTGGAAGTATTAAGCACCGGTATCTGGTAAATCTGCGAGGATA
TTGCAATTCTCCGACATCAAAGTTGTTGATATATGACTTTTTATCAGGAG
GTAGCCTAGATGAAGTTCTGCACGAGAGATCTGAGCAGTTAGACTGGGGT
GCACGGCTGACTGTAATCATGGGAGCTGCAAAAGGGCTGGCATATTTACA
TCACGATTGTTCACCTCGAGTAATACACCGTGACATAAAGTCTAGCAACA
TTTTGCTTGATGGAAACTTTGAGGCTCGAGTATCTGATTTTGGACTGGCC
AAATTACTCGGGGATGAGGAGTCTCACATCACAACAATTGTAGCTGGCAC
ATTTGGGTATTTAGCTCCAGAATACATGCAGAGTGGTAGGGCTACAGAAA
AGACAGATGTTTATAGTTNTGGAGTTCTGGTTCTTG
Genomic location of cLET-8-E2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3151 marker 3151
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)