SGN Marker cLET-5-O24

SGN-M3155

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C87817
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40405)
Chromosome
8
Position
47.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-5-O24 was used as an overgo probe on plate 12 [well G4]

Plausible BAC Matches:   P076J13

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GTTGAGAAGGCTTTGGAAGAGTCC
B sequence
CATCCAAGTCATTGCCGGACTCTT
AB sequence
GTTGAGAAGGCTTTGGAAGAGTCCGGCAAT
Marker sequence
TCAAGATAAAGCTTCGAATCCCCAAAACCTTTAGACTCGCAAAAAACCCT
AATTCCAATTCCAATTTCATTTCATATTATCAGCAAAATTAGTTTGATCT
GCCGAGAGGCAGACGGAGATTTACAATGTCTGCAATTGTCTGCGGCAAGA
GATCTTTCTTCGAAGATTTACAATCGCCGTCGCCGACATCAGCGTCGCCG
CCTGTTTCCAAGAAGATTCGTTGCTCTTCCTCTACTTCTCCGGTTCGGTT
CCCGACCAGTTTGATCGATCAACTGAGAACTTTGTTTCCTGATATGGATA
ATCAGGTTGTTGAGAAGGCTTTGGAAGAGTCCGGCAATGACTTGGATGCT
GCTATTAAGAGGTTACATGAGCTTCACCTTGTGTATGGCGATGCAAAGAC
AGTTGCTGATGGAGAGATGGATAATGGAGAAAAACCAACTAACGGGCCAG
ATGTTCAATCTGAAGGTCCTCCTCTCCAGAATAATCTTCCAGCTGATGGT
GCAGAATGGGTGGAGTTGCTTGTCAGGGAAATGATGAGTGCTACAAGTGT
AGATGATGCCAGGGCTAGGGCCACAAGGGTGTTGGAGAGCCTGGAGCGAT
CAATTAGTGTTCATGCTGGTGCTGCAGCAGCTTGAAAA
Genomic location of cLET-5-O24  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3155 marker 3155
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)