SGN Marker cLPT-1-J10

SGN-M3157

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C109914
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40457)
Chromosome
8
Position
62.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-1-J10 was used as an overgo probe on plate 12 [well D9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACAGTGGACTCAAGCTCAATACGG
B sequence
TGCACTTCCCGAACAACCGTATTG
AB sequence
ACAGTGGACTCAAGCTCAATACGGTTGTTC
Marker sequence
GATCACAGTGGGAAGATATTTCCGAGTGGAATATTCGGCGGACTCGTATA
AGAAAGCGGTGGACTCAGCAATTCAGAAACTCAGAAGCCAGGAAGGAAAT
CATAATGAAGACACCGACGATGCTGCTGAAACGCCGTCAACTCCAAAAAC
ACCAATAGAGCTGGCGATTGATTTCATTCTTCATGATTTTGAAATGGCAG
AAGTTGAGCCAATATCAACCTATGTAGATTTTGGTGAAAGAGAATTTCTG
GTTGCTGATGAAAGAGGATATGAACATTTGCTTTATAAAATGGCAGAAAA
TTTTCTTCTTACCTGTGAGGGTGAAATTATGGACAGTGGACTCAAGCTCA
ATACGGTTGTTCGGGAAGTGCACCACTCGAGAAACGGGGATTTGGTGACA
AC
Genomic location of cLPT-1-J10  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3157 marker 3157
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)