SGN Marker cLET-20-H18

SGN-M3160

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C82568
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40368)
Chromosome
8
Position
87.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-20-H18 was used as an overgo probe on plate 12 [well F9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGTATGCCTAGTGAGGTTCAAGGG
B sequence
GTAACGACATCCCAAGCCCTTGAA
AB sequence
TGTATGCCTAGTGAGGTTCAAGGGCTTGGG
Marker sequence
GGCATCCATGGCTACGGACCACTCTGATGATTTANACCAACTTCTTGACA
GTGCTTTGGACGATTTTCAGAGCCTCAATCTCACTACTGCTTCTCAAAGA
AATGGGGATGGAGAGGGCAAGAAAGAGAGTTCTTGTATGCCTAGTGAGGT
TCAAGGGCTTGGGATGTCGTTACCCAATTTGAAAGCTAAGAATAAAGGGA
AGCAAAAGGCTGCCAAGGAGGTGAAGGACCCGCATGTCTCGGAAGCTCTT
GATAAGCTTAGAGAGCAGACAAGAGAGGCTGTTAAAGGATTGGAATCAGT
GGCAGGGCCAAGACCCAGTGTGGAGAACTTTGGAAGTGATCCAATGATGG
AGGATTGGGTCAAACAGTTTGAGGAGCTGGCTGGTTCTCACGACATGGAG
TCTATTGTAGAGACCATGATGCAGCAGCTTCTTTCAAAGGAAATTCTTCA
TGAACCTATGAGAGAAATTGGAGAAAGATATCCACAATGGTTGGAAGACA
ATAAAGCCAATTTA
Genomic location of cLET-20-H18  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3160 marker 3160
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)