Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker cLPT-4-C24

SGN-M3162

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C110274
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51116)
Chromosome
9
Position
0.24 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40466)
Chromosome
9
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-4-C24 was used as an overgo probe on plate 14 [well E9]

Plausible BAC Matches:   P023O01,   P165F03,   P026I24,   P185E04,   P027I10

 Overgo Sequences

A sequence
AGTGCAATGTGTTGGGTGTTGGTC
B sequence
CACACACGATTGCTGTGACCAACA
AB sequence
AGTGCAATGTGTTGGGTGTTGGTCACAGCA
Marker sequence
CCCTTTCTTTTCGAAAACCCAGATCTGAAAAAGGGTCTCTGTTCATCAAA
TTTCAAACCCAAACCCTAAATTCTTCTCATTCACACGTTATTCCGATTCG
AATCAACCTTCAAAATTGATCCGAATCGAGAAATCTTCACACAACAATGG
GGGATTTCAATCTCGCCTTGGTTATTGTAGCCATTGTAGTATGTATTCTC
GTTTTCATAGTCAATGTCTATCTTCTCATCAATTATCAGCATCCTGATGA
TGCTAATCAAGCCTATTTCCCCAAATTTGTTGTCGCTTTTGGCTTATCAG
TCGCTGCCATTTCTATTCTCATGTTACCGGCCGATGTTGCTAATCGGCAG
GCATGTCAACACGCGATTTATAATGGAGCGTGTAATCTCACGCTCCCGAT
GAAGCAACTATGGCTTGCTATCTACATTGTTGATGCTATTCTCGTTTTCT
TCGTCATTCCTTGTGCTATGTTTTATTACGAAGGCGACCAGGATAAGACT
ATTGCCAAAAGGCTTAAAAGTGCAATGTGTTGGGTGTTGGTCACAGCAAT
CGTGTGTGCTT
Genomic location of cLPT-4-C24  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3162 marker 3162
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)