SGN Marker cLET-7-O3

SGN-M3164

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C88358
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51097)
Chromosome
9
Position
2.64 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49033)
Chromosome
9
Position
29.93 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40415)
Chromosome
9
Position
32.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-7-O3 was used as an overgo probe on plate 15 [well E2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTGCTACAAGGCTCTCAATGACC
B sequence
TCAAGGAGGACATGGTGGTCATTG
AB sequence
CTTGCTACAAGGCTCTCAATGACCACCATG
Marker sequence
GTTACCGAGCGCGTTCTTGCTGCTTGCTACAAGGCTCTCAATGACCACCA
TGTCCTCCTTGAAGGTACCTTGTTGAAGCCTAACAGTTGGGGNNNNTTNC
CCCCCCTCCTGGTTCTGAATCTCCCAAGGTTGCACCAGAAGTGATCGCTG
AGTACACCGTCCGTGCTTTGCAACGCACAATGCCACCCGCTGTTCCCGCT
GTGGTGTTCCTGTCTGGTGGTCAAAGTGAAGAGGAAACCACCGCCAACCT
CAACGCCATGAACAAGCTTCAAACCAAGAAGCCATGGTCGCTTTCCTTTT
CCTTCGGACGTGCTCTTCAGCAGAGTACCCTCAAGGCATGGGGAGGAAAA
GAAGAGAATGTTCACAAAGCACAAGCTGCATTCCTCACCAGGTGCAAGGC
CAACTCCGAGGCTACACTCGGAAAGTACGCCGGAGCTTCTAACTTGAGCG
AGGGCGCGTCCGAGAGCCTTCATGTTAAAGACTACAAGTACTAAGATCAA
CAAAG
Genomic location of cLET-7-O3  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3164 marker 3164
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)