SGN Marker cLET-7-D1

SGN-M3166

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C88146
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40410)
Chromosome
9
Position
38.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-7-D1 was used as an overgo probe on plate 15 [well H7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TTGAAAGCCTGGAAGGGACCAATG
B sequence
CTTCCTTGGTCAGGGTCATTGGTC
AB sequence
TTGAAAGCCTGGAAGGGACCAATGACCCTG
Marker sequence
AAGCTTTTATGTCACAAAAGGAATCTATATATATATAGTGAAATCAAGAA
AATCCCCATTTACTATTGTTGTGATTTTTTCTTGTCTTTGTAATGGCTAC
TAGGCCTCTAATTCAATTATCTTCTGTAGATCTTCATAAGAGTTCAGCTA
CAACAAGGATCTTGAGGACCCAAGTGAGATTCTTGGAAGTTGATAAACCC
CATTTGAGATTTTTGAATTTGCCTAGTTGTAATTCAACTCCAAAATTGAA
AGCCTGGAAGGGACCAATGACCCTGACCAAGGAAGTGGTGGATGAAAAAG
AGATGAGTGCTGTCACTGAACATGAATCGAATGAATTCACTACGTTGAAA
CATAGATTTTTGAATTTCAAGAAGGACAAATATTTGAAAAATTTGGAGCA
TTATCAGAGTCTTGCAGACGAACAATCACCAAAATTTTTGGTAATCTCTT
GTGCAGACTCTCGGGTGTGTCCCTCAAACATACTGGGATTTCAACCAGGA
GAAGCCTTTATAGTCCGCAATATCGCAAATTTGGTGCCTCCTTATGAGAC
TGATCCTTCAGAAGTAAAGGCAGCTCTTGAGTTTTCCGTTAATACTCTCA
AAGTCGAAAACATATTAATCATTGGTCATAGTCGCTGTGGAGGCATTCCT
GCTTTAATGAGCATGGATGATGAAACAAATTCCAGCTTT
Genomic location of cLET-7-D1  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3166 marker 3166
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)