SGN Marker cTOB-1-K3

SGN-M3167

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C119534
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51126)
Chromosome
9
Position
4.38 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49061)
Chromosome
9
Position
44.80 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40495)
Chromosome
9
Position
44.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cTOB-1-K3 was used as an overgo probe on plate 14 [well H12]

Plausible BAC Matches:   P055F03,   P275C21,   P023B15,   P308O20,   P317H24,   P308N16,   P255E01

 Overgo Sequences

A sequence
TCACTCTCCTACAGACCCGTTTCT
B sequence
AAATGGGTTCGGAGCAAGAAACGG
AB sequence
TCACTCTCCTACAGACCCGTTTCTTGCTCC
Marker sequence
GAAAATTTCAGATTCCTTCACACATCCTCTCTCTCTGTCCCCAAAACTCA
AACACTTTCAATTCACAATGGAATTACTTCTCTTCTTCTTCCTCACACCA
TTTCTCTTCTTTATTAACTGCTCTTCCATTACTCAAATTTCTTCACCATT
GTTGATTTTACCCCTAAAAACTCAACAAATCTCATCTGGGTTTTCATCTC
CAAATAAACTCCCATTTACTCACAATGTTACTCTTACTGTTTCCCTTTCA
GTTGGTACACCTCCACAGAATGTAACAATGGTGCTCGATACTGCTAGTGA
ACTTTCATGGCTACATTCAAATTCAACCCGAATCAAACAACCCATTTTCA
ACCCCAACCGTTCACTCTCCTACAGACCCGTTTCTTGCTCCGAACCCATT
TGCACGACCCGAACCCAAGATTTTTCCATACCAGCTTCTTGTGATTCGAA
GAATTTCTGTCATGCTGTGCTTTCTTACGCAGATGCTTCGTCTTCAGAAG
GGAATTTAGCTATGGATACGTTTACGATTGGCGGGTCGAATTTTACGGGT
ACGATATTCGGGTCAATGGATTCGGGTTTCAGTAGTGATTCGGATGAAGA
TGAAAAGACAACCGGGTTAATGGGTATGAACCCGGGATCTCTATCTTTTG
TTTCACAAATGGGGTTCAAAAAGTTTTCTTATTGCATTTCGAGCCTTGA
Genomic location of cTOB-1-K3  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3167 marker 3167
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)