Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker cLET-2-D4

SGN-M3168

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C84771
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51087)
Chromosome
9
Position
6.10 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49023)
Chromosome
9
Position
53.83 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40377)
Chromosome
9
Position
50.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-2-D4 was used as an overgo probe on plate 16 [well G7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGGAATCCCAAAACTGATTGCTGC
B sequence
GTCCGTACCAGTCAATGCAGCAAT
AB sequence
TGGAATCCCAAAACTGATTGCTGCATTGAC
Marker sequence
TGAAGCCCTCCTCTATAGTTTCCATTCTCTCTTTTTCCCTCTTCTTTCTC
TCTCAAATCTCTCCATCTCTTTCAGCTGAAAGATGTCACCCAAATGACAA
AAAAGCCCTCCTAGAATTCAAAAAAGCTCTAGGTAATCCTGATGATTTGG
GTAATTGGAATCCCAAAACTGATTGCTGCATTGACTGGTACGGACCTACT
CTCGAATGCGATGAAAAATCGAATCGGATTAATCTCATCGACTTCTCCAA
AATGAATCTCTCTGGATATCTCTCTCCCGCCATCGGAGATCTCACATACC
TTACGAAATTCAGTATCCACAATGTACGTAATCTCACCGGTCCAATTCCA
TCAACAATTGTTAAGCTCACGAATCTCATTTTCTTCAGAATTAGTGAATC
GGACATTTCAGGACC
Genomic location of cLET-2-D4  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3168 marker 3168
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)