SGN Marker cLET-7-N21

SGN-M3169

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C88338
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40413)
Chromosome
9
Position
50.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-7-N21 was used as an overgo probe on plate 6 [well A1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTTGAGGGATCATCCTACTTAGGG
B sequence
AGAATGGGAGTGGTTGCCCTAAGT
AB sequence
GTTGAGGGATCATCCTACTTAGGGCAACCA
Marker sequence
GTTGGTTGAGGGATCATCCTACTTAGGGCAACCACTCCCATTCTCCATTA
CAACATTGATCTGGATTGAGGTTCTTGTCATTGGATACATCGAATTTCAA
AGGAACGCCGAGCTTGACCCAGAAAAAAGGCTTTACCCAGGTGGATCATT
CTTCGATCCATTGGGCCTTGCTGCTGACCCGGAGAAAAAAGCCACCCTTC
AACTCGCTGAGATCAAGCATGCTCGGCTCGCCATGGTTGCGTTCTTGGGC
TTTGCTGTCCAAGCTGCTGCTACTGGAAAAGGCCCACTTAACAACTGGGC
TACCCACTTGAGTGACCCGCTTCACACTACCATTTTCGACACCTTCGGAT
TCTTCTCTTAATTAAGCAACATGCATGAGGATGGTTTTTACGTATATTAT
ATTAAATCTTCATCTTGTAAAAAAATGTAACATTAATTTGACACTTCAAG
GAGAAGCCTATATCAGACTTGTCGTTTTATTTTATC
Genomic location of cLET-7-N21  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3169 marker 3169
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)