SGN Marker TG101

SGN-M317

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
TG101 image not available
Forward sequence
GGGGATCGTCGACCTGCAGGGGGGGGGGGGCATGGACATTAAGTGCTAACAATAGTTTAATATCCATTTGTTTTTATCATCAGCATGGCT
TGAGTCTTTGTAATTTGTACTCCTTATTTAGATCTGCATTGTTTAAATTCAATCTAGCCACTTGCCATATATTAGTTTAAAAGTTGCTAT
GATTTGTCTTTGGTATATTGTTGCCCAATTATTTTTGGACGCAAATTGTTATTATCATTTTGTTGCATGTTATCACTCCGAGTCTATTTT
GGACTCCATCCTTGCATATCATCGAGTTGTTTCGAATTAGCCTCTGTTCTATTTGGATCGTTGGAAGCTGAAACATAGAACGGAAAGCCG
AAACACNACCTCCAAAAG
Reverse sequence
GGGGGGGGGGGCTTAATCAGGCCCAAGAATGAGTTTGGCATATTTACTCAAAATCCAGCTGCTGGACTTTCCTTAAGGCCTTGGGCCATT
GTTGCTTTAGAGAATTTGAGTATACATTCAGCGTATACCATTCTATAAACGTTCATACAACATCTGAAACCATATATGTTCATACACAAC
CTATATTAGGACCCCCCAACACTGACATCCCGAAGTTTCATCCTTGTACTCCTGTATTACGAATTTGGGCCTAGTATATGATGTACATAA
GTGTTGTATATCAGTGTATATTTCTGCATATAACAGGTATACAACCTGTTTTTGGGCTTTTGGAGGTTGTGTTTCGGCTTTCCGTTCTAT
GTTTCAGCTTCCAACGATCCAAATAGAACAGAGGCTAATTCGAAACAACTCGATGATATGCAAGGATGGAGTCCAAAATAGACTCGGAGT
GATAACATGCAACAAAATGATAATAACAATTTGCGTCCAAAAATAATTGGGCAACAAT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8875)
Chromosome
9
Position
54.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG101 was used as an overgo probe on plate 16 [well D1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCCGAGTCTATTTTGGACTCCATC
B sequence
CTCGATGATATGCAAGGATGGAGT
AB sequence
TCCGAGTCTATTTTGGACTCCATCCTTGCA
Marker sequence
GGGGATCGTCGACCTGCAGGGGGGGGGGGGCATGGACATTAAGTGCTAAC
AATAGTTTAATATCCATTTGTTTTTATCATCAGCATGGCTTGAGTCTTTG
TAATTTGTACTCCTTATTTAGATCTGCATTGTTTAAATTCAATCTAGCCA
CTTGCCATATATTAGTTTAAAAGTTGCTATGATTTGTCTTTGGTATATTG
TTGCCCAATTATTTTTGGACGCAAATTGTTATTATCATTTTGTTGCATGT
TATCACTCCGAGTCTATTTTGGACTCCATCCTTGCATATCATCGAGTTGT
TTCGAATTAGCCTCTGTTCTATTTGGATCGTTGGAAGCTGAAACATAGAA
CGGAAAGCCGAAACACNACCTCCAAAAG
Genomic location of TG101  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D317 marker 317
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)