SGN Marker cLED-11-L12

SGN-M3171

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C15356
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40295)
Chromosome
9
Position
50.40 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLED-11-L12 was used as an overgo probe on plate 7 [well D4]

Plausible BAC Matches:   P192I23,   P228D22,   P234E08,   P092O17,   P145G18,   P190A10,   P324E19,   P007H12

 Non-Plausible BAC matches

P015N08,   P193N14,   P154C21,   P271E01,   P174O05,   P332L19,   P100A22,   P169I15,   P106L11,   P333N08

 Overgo Sequences

A sequence
ACCGACTTACAGGCTTCATAGGAG
B sequence
GATACTTGCCCTGCTGCTCCTATG
AB sequence
ACCGACTTACAGGCTTCATAGGAGCAGCAG
Marker sequence
ACCAAAATGACCTCTAATCAATTATCAAAAGAAATAGACTTTTGTCCACA
TCAGAAGTTAAAACAAAATCCTACTGATACAAAGAGTACAGTCACTCAAT
AATTCTGCATAATTAGTACGTAAAACTCCTAGAATTACAAGTAAATTCTG
GATTAACAGTCATGATTTCAACAAACTAAACACTATGTTAATGCTCTATG
ACATCCAAGTTTGAGGTTAGCCACAACACTGAAAATGAGTGAGGTTGTCA
TGTACTAGAATCTATCTCCGGCAGATTTCTCAACATCGTTGCAAAGTCAA
AATATCAGCTTTTTGCATAATCCTTTGTCAATTCTTTTATACCGACTTAC
AGGCTTCATAGGAGCAGCAGGGCAAGTATCAGAATCTCCACTAAGATGAG
GTGCAGAGGTAGGTGTCTTGTATCCATCAGAATCTGAAAGTGGAGTTGAG
GCTTTTAAATGAAGATCCTCATTAATAACTTGTAGGAGAGAATTGTACAA
CAATTCAAATAACATCTCATCCTCAGACACCGTTCCCACATTTTCACTGA
AATTCAAAGTCTCCTCAAAGTATAGCTGGCGTGTCACTTTGGCTCGTGAA
TCTGTAAAATAC
Genomic location of cLED-11-L12  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3171 marker 3171
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)