Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker cTOB-9-B13

SGN-M3172

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C123055
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40504)
Chromosome
9
Position
50.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cTOB-9-B13 was used as an overgo probe on plate 6 [well E5]

Plausible BAC Matches:   P003G08,   P128J07,   P115L14,   P229J06,   P232O07,   P281E08,   P085F01,   P229I05,   P126F17,   P109L02,   P016M18,   P277E04,   P152C16,   P020D05,   P124N08,   P113O19,   P035C15,   P266G13,   P215G07,   P190F02,   P074A19,   P205K20

 Overgo Sequences

A sequence
GCTCAGGCTTGTCATTGAAGAGTC
B sequence
ATCGCCGTAAGCACTTGACTCTTC
AB sequence
GCTCAGGCTTGTCATTGAAGAGTCAAGTGC
Marker sequence
GAAAGGGTTTACCAAACGCCGGCGAGGAAAGTGTATTTGCGGGTTCGAAA
GCAATCGAAGAAGGTGAAGACTGTTTTAGGTGTTGTTACATGTCTCACCT
TACTCATTACTCTCAGATTACTCATCCATGACCACAATCACTTCTTTGTT
TTAGCTGAGTTTGTTCATTTCATCGGTATCTTATGTTTGATTTACAAGTT
GTCTACTCTCAAAACTTGCTCAGGCTTGTCATTGAAGAGTCAAGTGCTTA
CGGCGATCTTTCTGGCTGTAAGAGTATTTTGTAGTTTCATCATGGAAGGA
GATATACACACCATTCTAGATTTTGTTACACTTGCGGCAACATTGTGGGT
AATATATATGATGAAGTTCAAGTTGAAGTCGTCCTTCATGACAGATCTGG
ATAATATGCACTATTTGTATTTGATTGTGCCTTGTGTGGTTGCAGCCTTC
TTAATCCATCCTGCTACGGCTCATAATTTCTTCTTCCGGATTCTTTGGGC
TTTTTGTGTATACATGGAGTCTATCTCAGTGCTGCCTCAGCTTCGCTTGA
TGCAGAATGTCCAGATAATTGAGCCGTTCACAGCTCATTATGTGTTTGCA
TTGGGTGTTGCAAGATTCTTGGGCTGTGCTCATTGGATTAATCAGGTCTA
TGACACTAGCGGAGCATATCTATATTTGGCTGG
Genomic location of cTOB-9-B13  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3172 marker 3172
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)