SGN Marker cLEB-8-N3

SGN-M3175

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C806
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40270)
Chromosome
9
Position
61.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEB-8-N3 was used as an overgo probe on plate 16 [well B4]

Plausible BAC Matches:   P280N01

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GAGGAAGAGGAGTTCAATACTGGG
B sequence
TGAGGACAGAAAGTGGCCCAGTAT
AB sequence
GAGGAAGAGGAGTTCAATACTGGGCCACTT
Marker sequence
AAAGAATTCGGCACGAGGACCAATGGAAGAGGATGCCCCTCAAGGGAAAA
ATGAGGAAGAGGAGTTCAATACTGGGCCACTTTCTGTCCTCATGATGAGT
GTTAAGAATAACACACAGGTGCTCATCAACTGTAGGAACAACAGGAAACT
TCTTGGTCGTGTGAGAGCATTTGATCGTCACTGCAATATGGTGCTTGAAA
ATGTTAGAGAAATGTGGACTGAGGTGCCCAAGACTGGAAAAGGAAAAAAG
AAAGCTGTTGCTGTTAACAAAGATAGGTTTATCAGCAAGATGTTCCTTCG
GGGAGATTCTGTGATCATTGTCCTCCGAAATCCTAAGAAGAGAGGTGAAT
TGGATTTCTGTGCTTTGGAGCAAAACTTGTAAGCAGCTAGGATTTGGACC
AGCTCTGTATAACCTTTTCTTATTCGGGAATTTGGCTAGGCAGAACACCA
CCTTTGATTGCTGT
Genomic location of cLEB-8-N3  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3175 marker 3175
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)