SGN Marker cLET-42-O2

SGN-M3178

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C86376
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40389)
Chromosome
9
Position
72.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-42-O2 was used as an overgo probe on plate 15 [well B7]

Plausible BAC Matches:   P250E08

 Overgo Sequences

A sequence
TACGCTGTTGCAGGAAGTGGTTAC
B sequence
CATCGCGGACATCAAAGTAACCAC
AB sequence
TACGCTGTTGCAGGAAGTGGTTACTTTGAT
Marker sequence
TTGCAAAGGATCCAAGAGAGGATGTCATACAGGCATGGTACATGGATGAC
AACGATGAGGACCAGAGGCTTCCTCATCACCGTGAGCCAAAGGAATTTGT
GTCTCTTGACAAGCTGGCTGAACTTGGAGTGCTCAGCTGGAGACTTGATG
CTGACAATTATGAGACTGATGAGGAGTTGAAGAAAATTCGGGAAGATCGT
GGATATTCATACATTGATTTCTGTGAGGTTTGCCCTGAGAAACTACCGAA
TTACGAGGAGAAAATCAAGAACTTTTTTGAAGAACACCTGCACACCGACG
AGGAGATCCGTTACGCTGTTGCAGGAAGTGGTTACTTTGATGTCCGCGAT
GTGAATGAGAGCTGGATTCGCGTCTGGGTAAAGAAAGGTGGAATGATTGT
TCTTCCTGCTGGAATCTATCACCGCTTCACGCTTGATTCAAGCAACTACA
TTAAGGCAATGCGTCTCTTTGTTGGTGACCCAATTTGGACTCCATACAAT
CGTCCACATGATCATCTTCCCGCAAGGCAAGAATATGTTGAGACGTTTGT
CAA
Genomic location of cLET-42-O2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3178 marker 3178
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)