SGN Marker TG399

SGN-M318

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CAAGTTACATATTGAAGGCTTTTGGAAATGCTAAAACCCTCAGGAATAACAACTCCAGTCGATTTGTCAGTCTCTACATCTTCCTTTGTT
TGCTATCTTTTTTTGGGGGGAGAGGGGAGAGGGAAATTAACCAATCTGATCCCTTGAGCTCACCACAAGCATATGAAACTTTTTTGCATC
ATCAACATTATGGATCTCTAACGAATCACTCTGGTTGAGAAAGTTGTACTCCGAAGCACCTTTCAGCTTAAGTTTATCTGCCAAAAGAAT
CACACAAATGTTCTGAATGTGAAGGTACAAAATCTTTCAAGGACTTCAATGTTTAACACCCACCTCTCCTTTTAAAAAAGAGACACAAAA
AAGAATTATTCAGAGCTGTAGAGTATTGAATCACACATCTAGCCAAGAAACAGTGGTCCCACTTCTAGAATAATCGAAAGCCAAAGAAGT
TGAAATGCCTAATATTATGTCAGGTGGTCTTTTGAACCAAAAAGAAAAAAGCACACATATATGT
Reverse sequence
CTCACTATAGGGAGACAGCTTGCATGCCTGCAGCAACCATCTGAAAAGTATGTTCCTGGTCTCTTTCAGAAATCCCCGCAGTGTTTAGGG
CTTTCTGAAAAGGGAGTACATCAAAGGAATTAATAACAACAAAATGATCCTACATTACTTTGAATTGAATGCAATAGAATTAAAATCTAA
ATTAACCAATCTGATCCCTTGAGCTCACCACAAGCATATGAAACTTTTTTGCATCATCAACATTATGGATCTCTAACGAATCACTCTGGT
TGAGAAAGTTGTACTCCGAAGCACCTTTCAGCTTAAGTTTATCTGCCAAAAGAATCACACAAATGTTCTGAATGTGAAGGTACAAAATCT
TTCAAGGACTTCAATGTTTAACACCCACCTCTCCTTTTAAAAAAGAGACACAAAAAAGAATTATTCAGAGCTGTAGAGTATTGAATCACA
CATCTAGCCAAGAAACAGTGGTCCCACTTCTAGAATAATCGAAAGCCAAAGAAGTTGAAATGCCTAATATTATGTCAGGTGGTCTTTTGA
ACCAAAAAGAAAAAAGCA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53295)
Chromosome
10
Position
39.22 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8877)
Chromosome
10
Position
2.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8876)
Chromosome
8
Position
28.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG399 was used as an overgo probe on plate 14 [well C7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P161A12,   P134F18,   P137K24,   P040L19,   P040N21,   P190B15

 Overgo Sequences

A sequence
CTCTGGTTGAGAAAGTTGTACTCC
B sequence
AGCTGAAAGGTGCTTCGGAGTACA
AB sequence
CTCTGGTTGAGAAAGTTGTACTCCGAAGCA
Marker sequence
CAAGTTACATATTGAAGGCTTTTGGAAATGCTAAAACCCTCAGGAATAAC
AACTCCAGTCGATTTGTCAGTCTCTACATCTTCCTTTGTTTGCTATCTTT
TTTTGGGGGGAGAGGGGAGAGGGAAATTAACCAATCTGATCCCTTGAGCT
CACCACAAGCATATGAAACTTTTTTGCATCATCAACATTATGGATCTCTA
ACGAATCACTCTGGTTGAGAAAGTTGTACTCCGAAGCACCTTTCAGCTTA
AGTTTATCTGCCAAAAGAATCACACAAATGTTCTGAATGTGAAGGTACAA
AATCTTTCAAGGACTTCAATGTTTAACACCCACCTCTCCTTTTAAAAAAG
AGACACAAAAAAGAATTATTCAGAGCTGTAGAGTATTGAATCACACATCT
AGCCAAGAAACAGTGGTCCCACTTCTAGAATAATCGAAAGCCAAAGAAGT
TGAAATGCCTAATATTATGTCAGGTGGTCTTTTGAACCAAAAAGAAAAAA
GCACACATATATGT
Genomic location of TG399  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D318 marker 318
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)