SGN Marker I2

SGN-M3182
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the Immunity to Fusarium wilt race 2 locus.

Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39112)
Chromosome
11
Position
91.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 12952)
Chromosome
11
Position
97.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
I2 was used as an overgo probe on plate 13 [well F9]

Plausible BAC Matches:   P208C24,   P146K02,   P061P01,   P149H19,   P314C11,   P256L24,   P119C21,   P204P02,   P097E18,   P021F13,   P240F19,   P293O05,   P238D24,   P334O17,   P100L22,   P154A04,   P284P01,   P234L07,   P239A23,   P094L24,   P268A15,   P091L11,   P098B08,   P007E24,   P267F05,   P006M21,   P153I14,   P194F07,   P153P18,   P032F07,   P248O03,   P190K17,   P211G18,   P097C20,   P027I16,   P206D01,   P187L16,   P059I09,   P013I23,   P032G04,   P244N19,   P020C04,   P122B09,   P127B18,   P014I23,   P118N08,   P189N24,   P261G04,   P227N21,   P233N10,   P106D09,   P041D17,   P015P03,   P319H17,   P275P05,   P268P01,   P222B13,   P208H05,   P311O14,   P111K24,   P192A16,   P124K11,   P262E03,   P160L03,   P272A01,   P190J03,   P062O05,   P026H06,   P240D09,   P047B16,   P259D08,   P137C11,   P111L01

 Overgo Sequences

A sequence
TGGAGATTGGCTTAGCAGTTGGTG
B sequence
GAGGAGAGAAATGCACCACCAACT
AB sequence
TGGAGATTGGCTTAGCAGTTGGTGGTGCAT
Marker sequence
ATGGAGATTGGCTTAGCAGTTGGTGGTGCATTTCTCTCCTCAGCTTTGAA
TGTTCTGTTTGATAGGCTTGCTCCTAACGGTGATCTGCTCAACATGTTTC
GGAAGCATAAGGATCATGTTAAGCTCTTAAAGAAGCTGAAAATGACTTTG
CGTGGTATTCAGATTGTGCTAAGTGATGCAGAGAATAAGCAAGCATCAAA
TCCATCTGTGAGAGACTGGCTTAATGAGCTTCGAGATGCTGTCGACTCTG
CTGAAAATTTAATAGAAGAAGTCAATTATGAAGCTTTGAGGCTTAAGGTG
GAAGGTCAGCATCAGAATTTTTCAGAAACAAGCAACCAGCAAGTAAGTGA
TGATTTTTTCCTTAACATAAAGGACAAGCTGGAAGACACTATTGAAACAT
TAAAGGATTTGCAAGAGCAAATTGGTCTCCTTGGCTTAAAGGAGTATTTT
GATTCCACGAAACTAGAAACTAGAAGACCTTCAACTTCTGTGGATGATGA
ATCTGATATCTTTGGTAGGCAGAGCGAAATAGAGGATTTGATTGACCGTC
TATTGTCTGAAGGTGCAAGTGGGAAAAAGCTGACAGTAGTTCCTATCGTT
GGAATGGGCGGCCAGGGCAAGACAACACTTGCTAAAGCCGTATACAATGA
TGAGAGGGTGAAGAATCATTTTGATTTGAAAGCGTGGTATTGCGTTTCTG
AAGGATTTGATGCTTTGAGAATAACAAAAGAATTACTCCAAGAAATTGGC
AAATTTGACTCGAAGGATGTCCACAACAATCTTAACCAGCTTCAAGTCAA
ATTGAAGGAAAGTTTGAAGGGAAAGAAGTTCCTTATTGTTTTGGATGATG
TGTGGAATGAAAATTACAACGAGTGGAATGACTTGAGAAATATTTTTGCA
CAAGGAGATATAGGAAGTAAGATCATTGTGACGACACGCAAAGACAGTGT
TGCCTTGATGATGGGAAATGAGCAAATTCGCATGGGCAATTTGTCTACCG
AAGCCTCTTGGTCTTTATTTCAAAGACATGCATTTGAAAACATGGATCCT
ATGGGACATCCGGAACTTGAAGAGGTCGGAAGACAAATTGCAGCCAAGTG
CAAAGGACTGCCCTTAGCTCTGAAGACGCTCGCTGGCATGTTACGCTCCA
AATCAGAGGTTGAAGAGTGGAAACGTATTTTGAGAAGTGAAATATGGGAG
CTGCCACACAATGACATATTACCAGCGTTGATGTTGAGCTACAATGATCT
TCCCGCACATTTAAAGCGATGCTTTTCTTTTTGTGCAATATTTCCTAAAG
ATTATCCATTTAGGAAAGAACAAGTTATTCATCTATGGATTGCCAATGGT
CTCGTACCAGTGAAAGATGAAATAAATCAAGATTTAGGCAACCAATACTT
TCTAGAGTTGAGATCAAGATCATTATTTGAAAAGGTCCCAAATCCTTCTA
AAAGGAACATAGAGGAATTATTCCTTATGCATGACCTTGTCAATGATTTA
GCCCAACTTGCATCTTCAAAACTTTGTATCAGGTTAGAAGAGAGCCAAGG
ATCTCATATGTTGGAACAATGTCGGCACTTATCTTATTCAATAGGATTTA
ATGGTGAGTTTAAGAAATTGACACCCCTCTACAAATTGGAGCAGTTGAGG
ACATTGCTTCCGATACGTATTGAATTCAGATTGCACAATCTAAGCAAGAG
GGTGTTGCATAACATACTGCCTACACTAAGATCCTTGAGGGCCCTATCAT
TCTCTCAATACAAGATTAAGGAGTTGCCAAATGACTTGTTTACCAAATTA
AAGCTCCTCAGATTTTTGGATATTTCTCGGACATGGATTACAAAGTTGCC
GGATTCCATTTGTGGATTATATAACTTGGAGACACTTCTCCTGTCATCTT
GTGCTGATCTTGAGGAGCTACCGCTGCAGATGGAGAAGTTGATTAACTTG
CGTCATCTTGACGTAAGCAACACTCGGCGCTTGAAGATGCCACTACATCT
GAGCAGGTTGAAAAGCCTCCAAGTGTTGGTGGGACCCAAGTTTTTTGTAG
ATGGTTGGAGAATGGAAGATTTGGGTGAAGCACAAAACTTACATGGATCT
CTATCAGTTGTGAAGTTGGAAAATGTGGTTGATAGAAGGGAAGCTGTGAA
GGCAAAGATGAGGGAGAAGAATCATGTTGAGCAATTATCATTGGAGTGGA
GTGAAAGTAGTATTGCCGACAATTCACAAACAGAAAGTGACATACTTGAT
GAGCTATGCCCACATAAAAACATCAAAAAAGTCGAAATCAGTGGATATAG
AGGGACAAACTTTCCCAATTGGGTAGCTGATCCTTTGTTTCTTAAGCTGG
TGAATTTGTCTCTAAGAAACTGCAAGGACTGTTACTCCTTGCCAGCACTA
GGACAACTCCCTTGTTTGAAATTCCTTTCCGTTAAAGGGATGCATGGAAT
AAGAGTGGTGACGGAAGAATTCTATGGCAGATTGTCCTCCAAAAAGCCTT
TTAACTCTCTAGAGAAGCTTGAATTTGAAGATATGACGGAGTGGAAGCAA
TGGCACGCACTAGGAATTGGAGAGTTCCCTACACTTGAGAACCTTTCAAT
TAAAAATTGCCCTGAGCTCAGTTTGGAGATACCCATCCAATTTTCAAGTT
TAAAAAGGTTAGAAGTTAGTGATTGTCCAGTTGTTTTTGATGATGCCCAA
CTGTTTAGATCCCAACTTGAGGCAATGAAGCAGATTGAGGAAATAGATAT
ATGTGATTGTAACTCTGTTACCTCCTTTCCTTTTAGCATACTGCCAACTA
CCTTGAAGAGAATACAGATATCTCGTTGCCCAAAATTGAAATTGGAGGCG
CCAGTTGGTGAGATGTTTGTGGAGTATTTGAGAGTGAATGATTGTGGTTG
TGTAGATGATATATCACCTGAGTTTCTCCCAACAGCACGTCAATTGAGTA
TTGAAAATTGCCAGAACGTTACTAGGTTTTTGATTCCTACTGCCACTGAA
ACTCTCCGTATTTCGAATTGTGAGAATGTTGAAAAACTATCGGTGGCATG
TGGAGGAGCGGCCCAGATGACGTCACTGAATATTTGGGGATGTAAGAAGC
TCAAGTGTCTTCCAGAACTCCTTCCATCTCTCAAGGAACTGCGTCTGTCT
GATTGTCCAGAAATAGAAGGAGAATTGCCCTTCAATTTAGAAATACTCCG
TATCATATATTGCAAGAAACTGGTGAATGGCCGAAAGGAGTGGCATTTAC
AGAGACTCACAGAGTTATGGATCGATCATGATGGGAGTGACGAAGATATT
GAACATTGGGAGTTGCCTTGTTCTATTCAGAGACTTACCATAAAGAATCT
TAAAACATTAAGCAGCCAACATCTCAAAAGCCTCACCTCTCTTCAATATC
TATGTATTGAGGGTTATTTATCTCAGATTCAGTCACAAGGCCAGCTTTCC
TCCTTTTCTCACCTCACTTCGCTTCAAACTCTACAAATCTGGAATTTCCT
TAATCTCCAATCACTTGCTGAATCAGCACTGCCCTCCTCCCTCTCTCACC
TGGAGATAGATGATTGCCCTAATCTCCAATCACTCTTCGAATCAGCACTG
CCCTCCTCCCTCTCTCAGCTGTTCATCCAGGATTGCCCTAATCTCCAATC
CCTTCCATTTAAAGGGATGCCCTCTTCCCTCTCTAAACTATCTATTTTCA
ATTGCCCATTGCTCACACCACTACTAGAATTTGACAAGGGGGAATACTGG
CCACAAATTGCTCATATTCCCATCATAAATATCGATTGGAAATATATTTA
A
Genomic location of I2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3182 marker 3182
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)