SGN Marker TG102

SGN-M319

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
900
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
Forward sequence
ATCGGGGATCGTCACCTGCAGGGGGGGGGGGCGGGGGGAGGAANAACTTTTATCTGCTTAAAAAGATTTTGACTGAGTATTAGTAGAGTA
GGACCCCAAGCAAAATATCAGTGATGCTATGGGGATATTATCCTGAAGCTTTTCTGAAACATATAAACGAAATGCTAATGCATCTCCATC
ATTCCAATTCTACATTCTATATTCTATCCTTTACTTTTTCTTTTCAGTAGATTTATCCAACACATTTCCCATACATCAATATCATAGCTA
TGCCAAATAACTGGACAGTACATTCCTTTGCTGAAGAAATTAGAAGACAATTGCTAGGAGGAAGTGTAAGAAGGATCATTCATCTCTTCA
ATTAATTAATAGCAGGTGTTGCAGCGGTCATTAGGAAATGTTGTCTGATCTGAGAATCTTTTGGCTATCCTGCAGTTTTTATGGTCAAAT
GACAGAAACTTAATATTGTGCGTAGTGTAAAGCTTAAGCATTGTAGTCATCACTGGCATTCTGGAACCATGTTTTCTATGTTTAGCT
Reverse sequence
GGGGGGGGGGAATCCAAGAAATCTAAGTATGCATTTTTATTCAATTTTGAGGAGACCTTTGAAAGATAAATCTGGAGGACATCTTTCTTC
CGTGAAAGCCTCATAAATACACAAACCTAGTTAATCCCAGATATTCATAAATTCAGTAATCGATCACACTGTTGTTTTTTGCCCTTCCAC
AGAGAAACATGGGAAAACAATGAAGAACATAACCTAGTAACAAAAAACTTACTTAAGTTTTGACAACAGGTTTATGGCTTCATCAACAGC
AACACTAGCAGCATAAAGCCCCAACTTCTTCACCTATAACAATATCATCAAACAATCACTTGTACAAAAGATAAGGACACTTCGAGAGCA
TGATGCATCACATTTTTCAAGCACATGTCTGTGACTAAAAAGTAGTTTCTTACATTTACAGTTTCATATCAGGGATCAGCAAAATAGCAA
GCAGAAATGATACCCATCACTTACTTTGAGTATTCAAGTGCCAAATGTTAATCAAGAAACCAGAAAGAACTAACCGATC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53155)
Chromosome
2
Position
43.09 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53154)
Chromosome
3
Position
56.79 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Pepper-AC99   
Map version
34 (location: 8879)
Chromosome
3
Position
72.62 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8878)
Chromosome
3
Position
63.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG102 was used as an overgo probe on plate 14 [well E5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P140F15,   P186I02,   P006J14,   P330F07,   P252B12,   P031P17,   P327L04,   P048D15

 Overgo Sequences

A sequence
GCTTAAGCATTGTAGTCATCACTG
B sequence
CATGGTTCCAGAATGCCAGTGATG
AB sequence
GCTTAAGCATTGTAGTCATCACTGGCATTC
Marker sequence
ATCGGGGATCGTCACCTGCAGGGGGGGGGGGCGGGGGGAGGAANAACTTT
TATCTGCTTAAAAAGATTTTGACTGAGTATTAGTAGAGTAGGACCCCAAG
CAAAATATCAGTGATGCTATGGGGATATTATCCTGAAGCTTTTCTGAAAC
ATATAAACGAAATGCTAATGCATCTCCATCATTCCAATTCTACATTCTAT
ATTCTATCCTTTACTTTTTCTTTTCAGTAGATTTATCCAACACATTTCCC
ATACATCAATATCATAGCTATGCCAAATAACTGGACAGTACATTCCTTTG
CTGAAGAAATTAGAAGACAATTGCTAGGAGGAAGTGTAAGAAGGATCATT
CATCTCTTCAATTAATTAATAGCAGGTGTTGCAGCGGTCATTAGGAAATG
TTGTCTGATCTGAGAATCTTTTGGCTATCCTGCAGTTTTTATGGTCAAAT
GACAGAAACTTAATATTGTGCGTAGTGTAAAGCTTAAGCATTGTAGTCAT
CACTGGCATTCTGGAACCATGTTTTCTATGTTTAGCT
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG102  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D319 marker 319
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)