SGN Marker TG274

SGN-M32

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTATAAATCGAATGATGAAGTTTAAGATGGGGCAATGCCTTGTGTAGAAAGGACATAATTTCGTGTATTTTTAAATGAGTACTATAAAAA
TATTTCAAGAGATGAAACCTCATCAAGAGAAACGAATATACTTTTACTATTAGGATTTCTTTTGTTGACTTCTATATGTTAGTCTTGATT
TTATAAAATTGTGTTTCTGTTACAATTCTTATTATGGTTTCGTTAAATATTGTGCTGTTTGATTTACAACTTTTGGTGCACGCACATCAA
AAGTTTTATTTGACATCATTCAAAAGTTTGAACGTCCTTGATGAAATTCCTTGCTACGCCACTGCCTTTGTCAGTGGGAGTTAGCATGTT
CTTTGTGGAATTATTTGAAGTGCACTAGCTGGCCTCAACACCAGTGTTCTCAAAAAAGAAAAATGAAATGACTTGTTTTCACGTTAAGAA
GTGAGTTTCAAGATAAATGGTGAAAGCATATATCTTTTAGTGACCTGGTGGAATATGTGAACCTAATATTACCTTCAAATTCTTTTAAAA
TTTTAATGGGA
Reverse sequence
CTCTACTGTACATACCAAATACAATGCGATTACTAACAACAGCCCTCAAGTTACATATACAAGTCCAACTTTTGAGTAACGACACAGTCA
AGCTTTAGCTTTAGAGGGAGTTGCTATCAAATGATGTAAAGTTGACGCCTGGATAACAGTGCTAGGACTAGTATCTCTACTCCGTGTTGC
CACAGATTGCCTAACACCTATGTTTTTGTCAACCCCACTTCTTACAACATGTATCCAAGACCGGGGAAGGCTTCTCACCAGCCGTGTTGA
AGCTACCAGCAGAATCACACCAACAATGATGCACATCCTGTACACAAACATCTCAATATCAACAGCATTTCTTTTGCTACAGCAAAAAGT
CTCCATATCCCTTATAAATGTAGGAATCCCACCAGGAAGACGACCAAAGCATTTAAATAACAGATATAAACCACGAATACAAAAGATGCA
ACACTCTAATTTAACATGCGAACTGATGTGCACTTATTCCCAAAAAAGGGAAAAAAAAAGAATCAGCTGTGTACTTTAGTTCAAAACATC
TTGTAATGCGCTAATAATATGATGGTACTTATG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53531)
Chromosome
6
Position
12.76 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7811)
Chromosome
6
Position
8.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG274 was used as an overgo probe on plate 2 [well C4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AATTCCTTGCTACGCCACTGCCTT
B sequence
CTAACTCCCACTGACAAAGGCAGT
AB sequence
AATTCCTTGCTACGCCACTGCCTTTGTCAG
Marker sequence
CTATAAATCGAATGATGAAGTTTAAGATGGGGCAATGCCTTGTGTAGAAA
GGACATAATTTCGTGTATTTTTAAATGAGTACTATAAAAATATTTCAAGA
GATGAAACCTCATCAAGAGAAACGAATATACTTTTACTATTAGGATTTCT
TTTGTTGACTTCTATATGTTAGTCTTGATTTTATAAAATTGTGTTTCTGT
TACAATTCTTATTATGGTTTCGTTAAATATTGTGCTGTTTGATTTACAAC
TTTTGGTGCACGCACATCAAAAGTTTTATTTGACATCATTCAAAAGTTTG
AACGTCCTTGATGAAATTCCTTGCTACGCCACTGCCTTTGTCAGTGGGAG
TTAGCATGTTCTTTGTGGAATTATTTGAAGTGCACTAGCTGGCCTCAACA
CCAGTGTTCTCAAAAAAGAAAAATGAAATGACTTGTTTTCACGTTAAGAA
GTGAGTTTCAAGATAAATGGTGAAAGCATATATCTTTTAGTGACCTGGTG
GAATATGTGAACCTAATATTACCTTCAAATTCTTTTAAAATTTTAATGGG
A
Genomic location of TG274  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D32 marker 32
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)