SGN Marker TG103

SGN-M320

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
TG103 image not available
Forward sequence
GGGATCGTCGACCTGCAGGGGGGGGGGGCGGGGGGGGAAAAAATATTTAGATCTAGTTCATAGGGAAATTATGTTGTGTGGAGCAGAAAG
TTGACAAGTCATGAATTCACATGTTCAGGAAATGGAAGTTATGAAAATGAGAATGTTGGTGTGGGAATACCAAGACAAATAGAATAAAAA
ATACAGATATTCGAGACAAGATTGAAATTGTATTAGTGAAGAACAAGAAGGCAGAAGCGGAATGTTAAGTTGGAATAGTTCCTACATATG
AGTAGGACATATGCATAATGTCATAAATATAAAGGCAAATACCGATAAATGTGGAAAATATATTAAAGGGAGATCAGGATTTTTACATAC
AGTATCGATGGCTAGTTCTAACGGAGAAATCAAAATTTTTATTGAGAAATTTAAAATAAGAAAAAGTCATAAAAGAGATTATCAAATTTA
TCGATTTAAAGTGAAAAAGTGATGAATTTCTAAATTTATAAATTGCGTAAAAAAAAATGATGAAATAATCATAGTAA
Reverse sequence
GGGGGGGGGGGGGGTGTCGGATCACAAAAATTTCTAGTGATATTTCTATGTAGGACACCACATAAGATGTAAATTGTCATGTAAAATATT
CGGTAGGACGTGTATCCCTATTTATGCATCATACCTAAAATTAAAAAACATAAATATAAATTAAAATTAAATTAAATGATATATTTATTT
ATTTTGCATAAAATTAAACAGTTATGATTAATTGACTAGGGACTTGTTGTATATGTTATTAATAACAAACTTTTAAAGGAAAGGGCCAAG
TGGAAGAAGGTGGAATAGACAGATAAAAGTGAAAGCCATGAACCACTCATTATTTATCATAATTGGCTGAATGCTGATGAGTGATGATGG
TAAATATATAGTGTGGACTGTGGACTTACTTCCCACTACATCTGTACTGCACTCTGGGGTTCACATTATCGGGAGGTCACAGGTTAAAAC
TGTATACGTGATAAGGTTGTGTAATAGACTTTTATATAGCTGATAGAATCACAAACTCGATTAAACTTA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53156)
Chromosome
10
Position
49.37 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8880)
Chromosome
10
Position
33.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8881)
Chromosome
10
Position
7.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG103 was used as an overgo probe on plate 15 [well C2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGAGCAGAAAGTTGACAAGTCATG
B sequence
CCTGAACATGTGAATTCATGACTT
AB sequence
GGAGCAGAAAGTTGACAAGTCATGAATTCA
Marker sequence
GGGATCGTCGACCTGCAGGGGGGGGGGGCGGGGGGGGAAAAAATATTTAG
ATCTAGTTCATAGGGAAATTATGTTGTGTGGAGCAGAAAGTTGACAAGTC
ATGAATTCACATGTTCAGGAAATGGAAGTTATGAAAATGAGAATGTTGGT
GTGGGAATACCAAGACAAATAGAATAAAAAATACAGATATTCGAGACAAG
ATTGAAATTGTATTAGTGAAGAACAAGAAGGCAGAAGCGGAATGTTAAGT
TGGAATAGTTCCTACATATGAGTAGGACATATGCATAATGTCATAAATAT
AAAGGCAAATACCGATAAATGTGGAAAATATATTAAAGGGAGATCAGGAT
TTTTACATACAGTATCGATGGCTAGTTCTAACGGAGAAATCAAAATTTTT
ATTGAGAAATTTAAAATAAGAAAAAGTCATAAAAGAGATTATCAAATTTA
TCGATTTAAAGTGAAAAAGTGATGAATTTCTAAATTTATAAATTGCGTAA
AAAAAAATGATGAAATAATCATAGTAA
Genomic location of TG103  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D320 marker 320
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)