SGN Marker TG104

SGN-M321

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
700
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
Forward sequence
GGGGGGGGCCTTTCCCCCCAAAAAAATTTTCAAAAAAATTGCCCACTTCCCCGGGGTTTAAATTTAATTGGGAAATTCCCCTTCCCGGGG
GAGAAAAAAAATTGGGGGGGGGGGTTTGACCCCCTAACCCTGAATTTGCCTTGGGGGAATTTTTACTTACAACAAGTTTGGGAAGGACAT
CCTTTTCTTAAAAACCCTTTTTAAAAAATGGGAAAAAGGGGCCCCCCCCCCCTTTTTTCCTACATTTTTCTCCCCCCCTTTTTTCAAGGC
CAAAAACAGGGGAAAAAAGTTGGGGGCCCATTTCAACAATTGGCGGGGAAAATTTAAAAAAAATTTTTAAAGTTTCCCCCCCAAAACCTT
CCCTTTAATTTGAAAAGTTGTGGCCAAAGTTTAAAAAAAACAAAACAAGGGGTTAACCCAAATTAAAAAAGGGCCCGGGGGTTCCCCCCC
TGGGAAAAACCAAAAAAAACCCTTTTCCCCCATTTTTCCCCTAACAATTTTTCCCCCTTAAAATTTTGGGGGGGATTTTTAGGGGGGGGG
GGGGGAAAAA
Reverse sequence
GGGGGGGGCCATTTCCCCAAAAAAAACTTTCAAAAACTTGGGCAACTTCCCCGGGGTTTAAATTTAATGGGGAAATTCCCCATCCGGGGG
AAAAAAAAAAATTGGGGGGGGGGGGATGAACCATTAACCCTAAATTTGCTTTTGGGGCCCTCAAACCTCCCACAATTTTAGGAAGGTCCT
CCTTTTTCCCCAAAACCTTTTTCAAAAATGGGAAAAAGGGGCCCCCCCCCCCTTTGGTCCCCCACTTTTCCCCCCCCCTTTTTTCAAGGC
CAAAAACAGGGGAAAAAAATTGGGGGCCCTTTTCCACAATGGGCGGGAAAAATTGAAACAAAATTTTTAAAGGCCCCCCCCCCAAACCTT
CCCTTTAATTTGGAAAGGTGGGGGCAAAGTTTAAACAAAACAAAACCGGGGGTTAACCCAAAATAAAAAAGGGCCCGGGGGTTCCCCCCC
TGGGAAAACCCCAAAAAAACCCCTCTCCCCCATTTTTCCCCTAACAATTTTTCCCCCCTAAAATTTGGGGGGGGGTTTTTAGGAGGGGGG
GGG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8882)
Chromosome
11
Position
87.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG104 was used as an overgo probe on plate 10 [well C10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGAAAAAAGTTGGGGGCCCATTTC
B sequence
TTCCCCGCCAATTGTTGAAATGGG
AB sequence
GGAAAAAAGTTGGGGGCCCATTTCAACAAT
Marker sequence
GGGGGGGGCCTTTCCCCCCAAAAAAATTTTCAAAAAAATTGCCCACTTCC
CCGGGGTTTAAATTTAATTGGGAAATTCCCCTTCCCGGGGGAGAAAAAAA
ATTGGGGGGGGGGGTTTGACCCCCTAACCCTGAATTTGCCTTGGGGGAAT
TTTTACTTACAACAAGTTTGGGAAGGACATCCTTTTCTTAAAAACCCTTT
TTAAAAAATGGGAAAAAGGGGCCCCCCCCCCCTTTTTTCCTACATTTTTC
TCCCCCCCTTTTTTCAAGGCCAAAAACAGGGGAAAAAAGTTGGGGGCCCA
TTTCAACAATTGGCGGGGAAAATTTAAAAAAAATTTTTAAAGTTTCCCCC
CCAAAACCTTCCCTTTAATTTGAAAAGTTGTGGCCAAAGTTTAAAAAAAA
CAAAACAAGGGGTTAACCCAAATTAAAAAAGGGCCCGGGGGTTCCCCCCC
TGGGAAAAACCAAAAAAAACCCTTTTCCCCCATTTTTCCCCTAACAATTT
TTCCCCCTTAAAATTTTGGGGGGGATTTTTAGGGGGGGGGGGGGGAAAAA
Genomic location of TG104  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D321 marker 321
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)