SGN Marker TG105

SGN-M322

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
Forward sequence
GGGATCGTCGACTGCAGGGNNGGGTTGCGGGGGGGGAAAAAATTTTTGAAACGAATGCTTCATGTATACAATTCAGCAATGCAATGAGAA
AAAGGAAGAGTAGTAGTCAGTGAGTTTTCTTCATACTCACTCACATGAACTGGGAGAAATGCCAAATATCCCAACTTAGTTTTGGTTATT
AGACGAAAAACGTCATTCTTCAGCTATTTAATTGTTGGATTTCATCTTATTGCTGATATATAGGCCAATTCCAAGAACCAAAAGAGCAAT
CAGAGTCATGTTCATCAATTTCCTTGGCATCTTCAGCTTCTCAGCTAGAACAGTTGCAGTTCCAGTATATGCATCTTTATCAAGTTTACA
CGCATAACTCGGTTTATTTCCATCTTCCACAGTGCTACTTGCACCTGTCCTTTCAGCAGGTGTTTTTTCCGCGAGATCATTAGCTTCTTT
TGGGTTTGGTTCTTCCATTTCAGGCTTGTCAGCATTAGTATCCTGATGTTTAGGCAATTCTTCTGTTGGTGTTG
Reverse sequence
GGGGGGGGGGGGGGGGCGTTAACAAAAGAGATTATTTTCATGGGACCCCATAATATATCAGATGACATAATAGGATGTAAATGTCACATT
TGTTGCTTGGACCATCCAAAAGTTTTGCTGTATCTGTGTTAGATTCTCTAAAAACGGACAGATTTTTGAAGAGTTCGAGCAACATAGCAT
ATCGACAGTGCAGGACCTACCTTGGCTCGACACTCCTTTGTCGGAAAATTACGTTGTATATAGTGATTAAATTTTAGTTTTATAAATATA
AATACATAAATTGACATCTCTTAAAACAAGTTAAAGGGCTTAGTCTATTTGTTAGGGGTTTGCAAACACTATATGAGGTCGGGTGTGCCT
ATTTTTTTTACTGTACTCCTTAATGAAAATCCTGCGTCCGCCAGTGCATATCGATGTAGCTTATATTATGGTCTTTTTTCACATTTATTG
TCATGTTGAAATTCTGCAGGTTTCAAAAAGGAACAAGTGAGGGTTCAACTGACTAAAACAGGAATTCTGAAGAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1509921.8e-2265 (12.4% of RFLP seq)+
SGN-U1509921.4e-38150 (28.6% of RFLP seq)+
SGN-U1509922.8e-92222 (42.4% of RFLP seq)+
SGN-U1729503.7e-0532 (6.1% of RFLP seq)-
SGN-U1509926.7e-1658 (11.1% of RFLP seq)-
Mapped locations  
Map: Pepper Capsicum   
Map version
65 (location: 42833)
Chromosome
11
Position
57.20 cM
Confidence
uncalculated
Protocol
RFLP


Pepper Capsicum

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39893)
Chromosome
11
Position
90.00 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39894)
Chromosome
9
Position
0.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 8888)
Chromosome
11
Position
9.04 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8883)
Chromosome
11
Position
79.90 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG105 was used as an overgo probe on plate 14 [well A12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCCATCTTCCACAGTGCTACTTGC
B sequence
TGCTGAAAGGACAGGTGCAAGTAG
AB sequence
TCCATCTTCCACAGTGCTACTTGCACCTGT
Marker sequence
GGGATCGTCGACTGCAGGGNNGGGTTGCGGGGGGGGAAAAAATTTTTGAA
ACGAATGCTTCATGTATACAATTCAGCAATGCAATGAGAAAAAGGAAGAG
TAGTAGTCAGTGAGTTTTCTTCATACTCACTCACATGAACTGGGAGAAAT
GCCAAATATCCCAACTTAGTTTTGGTTATTAGACGAAAAACGTCATTCTT
CAGCTATTTAATTGTTGGATTTCATCTTATTGCTGATATATAGGCCAATT
CCAAGAACCAAAAGAGCAATCAGAGTCATGTTCATCAATTTCCTTGGCAT
CTTCAGCTTCTCAGCTAGAACAGTTGCAGTTCCAGTATATGCATCTTTAT
CAAGTTTACACGCATAACTCGGTTTATTTCCATCTTCCACAGTGCTACTT
GCACCTGTCCTTTCAGCAGGTGTTTTTTCCGCGAGATCATTAGCTTCTTT
TGGGTTTGGTTCTTCCATTTCAGGCTTGTCAGCATTAGTATCCTGATGTT
TAGGCAATTCTTCTGTTGGTGTTG
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG105  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D322 marker 322
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)