SGN Marker TG107

SGN-M323

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
400
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
TG107 image not available
Forward sequence
GGGGGGGGGGGCGGGGTTTAAAAGGTTTATCACTCCCTGTTCTACTCTCTGAAACTTTGAGAGACCATAAGGGTGACTCTGTGAAATGCA
CCAAAGGTATGCAGAAACTGTTAAGCAGAAACCCATCGTTACCGCCTCCAGTTCTATCCCTTAATCCCCTTCTTTCTTTACCTCTTTCTC
ATCCCATAGGGTTTTACAAACACCCACTTCCTCCCAGTCCTAGAATGACTTCTGCCGCCTTCCACCGGCTTCACCATCCCACTATCGGTA
AACCCTTTTTGGGTTTTCGGAATATGTCTACGGATTCTTCTGGAAAGGCAGTTGTTTCTCGTGGTGGTAATAATTGCCATATTTGTAGAT
GTTCTCTTGAAAATGCGCCGGTGAGGGCTTGGGTTGTTTTGAAGCAGAGTAGGACTAGTGCTGCCTGGTTTGGCACTCTGGCTTCGGCTT
CTGGGTCTGAGAAGGGTGTTCCCGTCACTTCTGCTGAGGAGGTGGAGGACTCCTTAAGTGG
Reverse sequence
GGGGGGGGGGGGGCTTTCCAGAACTCAAAATCTTCTCGTTGGATTTTCCAAAAAACTGCAAAGAAGCCAAAATACTGCCTTTTTACTATA
ACAAAGTATATCAAGTTTACAGGTCAAATAAGCTGCACAATTTCCTTAACATTACCCAAACATATTCTTTTAAGTTAAGTACTTCACCCT
GTTCAACTCAATAATAACTGCAAAACAGAGATACCAATTACTATTTTGGCTATCCAAATTGGTCAAGTTAAACAATTAACTGGATTCACA
AAAGAACATGCAGTCCTAGAAAATCCTAACATATCGAAAAATTGATAAGAGTCATGTCCAAGAAAATACAACTCAATAGTTCATGCCCAT
CCTCTTAACACTTCTAAGAGAGTCGTCCATCCATTTCGCCATGGAGGTTTCTATGCCATGCAGTTATTCAACTACAATGCTTGGTTAAAT
TAATCCTTTGTAGTTAGTCCGCTTTATTCAAGGTCAAGTCATTTCAATACTACTTTCTGTAGACCCTCTAAAATTA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U146845479 (93.7% of RFLP seq)+
SGN-U1468451.5e-0728 (5.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8891)
Chromosome
11
Position
47.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG107 was used as an overgo probe on plate 11 [well A2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P268E23,   P074E14,   P332F12,   P050C06,   P049O17,   P028C04,   P168K18,   P221K08

 Overgo Sequences

A sequence
CTACGGATTCTTCTGGAAAGGCAG
B sequence
CCACCACGAGAAACAACTGCCTTT
AB sequence
CTACGGATTCTTCTGGAAAGGCAGTTGTTT
Marker sequence
GGGGGGGGGGGCGGGGTTTAAAAGGTTTATCACTCCCTGTTCTACTCTCT
GAAACTTTGAGAGACCATAAGGGTGACTCTGTGAAATGCACCAAAGGTAT
GCAGAAACTGTTAAGCAGAAACCCATCGTTACCGCCTCCAGTTCTATCCC
TTAATCCCCTTCTTTCTTTACCTCTTTCTCATCCCATAGGGTTTTACAAA
CACCCACTTCCTCCCAGTCCTAGAATGACTTCTGCCGCCTTCCACCGGCT
TCACCATCCCACTATCGGTAAACCCTTTTTGGGTTTTCGGAATATGTCTA
CGGATTCTTCTGGAAAGGCAGTTGTTTCTCGTGGTGGTAATAATTGCCAT
ATTTGTAGATGTTCTCTTGAAAATGCGCCGGTGAGGGCTTGGGTTGTTTT
GAAGCAGAGTAGGACTAGTGCTGCCTGGTTTGGCACTCTGGCTTCGGCTT
CTGGGTCTGAGAAGGGTGTTCCCGTCACTTCTGCTGAGGAGGTGGAGGAC
TCCTTAAGTGG
Genomic location of TG107  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D323 marker 323
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)