SGN Marker TG109

SGN-M324

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2100
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
TG109 image not available
Forward sequence
ATCGGGGATCGTCACCTGCAGGGGGGGGGGGCGGGGGGGGGAAATTTCCAAAAAAGCTTCTCATATAGGACTATTACAAACTTAAATGAT
GTTACATGGATATTGACATATGAGGCTCCTCTTCATTATTAAATTTCTTAATTTCTGTAAGTTTACTTGATAAAAGTCATATGTCATAAT
CAAAAATTACGGGTTGAGATTTGCTCTAATTGTTCCCACTAAGCAATAGATGACTATTTTTTCAGAATTCAGCTCTGACAAATTCGATGT
TACAGACTATATATGTGTTTGTAAAATATCCAAGTAGTTAGCCAAATTTACTTTATTTCTAACAAGATTAAGGTGTGATCTAGAAAAAGA
AAATACAGAGATCTGAAGTCCATCAAATAAAAGTTTCAGAGACGAAAATTCTTTTTGTCATGAAATCATTTTTTACGTTAATGTAGGGAA
GAACTAAGGAAAATAATTTTGTAAATGTACAAAAAAAAAATTGTTCAAAATAAGGAGAGTTGATAATAGATAGAAAAAAAGTGAACTTT
Reverse sequence
GGGGGGGGGGGGTCATTCTTACAATAAAAAGGGTCGATCCAAACACTTCTTTTAAAAAAAGTAAATCAAACACAACATGTTTTTATTATA
TTAATTATATCCAAACATATATGTTCACCTTAGCCATAATTAAGGTGAAACTAAAAATACATTCCCGCAATTTAAGATAAATCTTACGGT
ATAATTTTAAGAGGCTCCAATAACTAGTTGAAAAAGAAAGAAAACAAAACAAAAACTCAAAGTTGATAAATATCAATTGTTGAATGTATA
CAACTAGCTAGGGTTGGAGCTAGAGGGCCGCCGTAGGATCATACCTTCTTTAATTTACATGAAAATTAGATAGTAGAAGATGAATTTTCA
GGATAAAAATCTTGCTTCTTTCTGTTAATGCAACCACCTATGTGTTTACTCAAACATCGCTTGACTTGACGAAAAACACTAGCAAATATT
CGTCTCTTGATTCTTCCTCTAACTGGAGGAACCCTCACATTCATAGTTTTTTTTCTGATTGAGGATGACATT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8892)
Chromosome
11
Position
47.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG109 was used as an overgo probe on plate 11 [well B1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CGGGTTGAGATTTGCTCTAATTGT
B sequence
CTATTGCTTAGTGGGAACAATTAG
AB sequence
CGGGTTGAGATTTGCTCTAATTGTTCCCAC
Marker sequence
ATCGGGGATCGTCACCTGCAGGGGGGGGGGGCGGGGGGGGGAAATTTCCA
AAAAAGCTTCTCATATAGGACTATTACAAACTTAAATGATGTTACATGGA
TATTGACATATGAGGCTCCTCTTCATTATTAAATTTCTTAATTTCTGTAA
GTTTACTTGATAAAAGTCATATGTCATAATCAAAAATTACGGGTTGAGAT
TTGCTCTAATTGTTCCCACTAAGCAATAGATGACTATTTTTTCAGAATTC
AGCTCTGACAAATTCGATGTTACAGACTATATATGTGTTTGTAAAATATC
CAAGTAGTTAGCCAAATTTACTTTATTTCTAACAAGATTAAGGTGTGATC
TAGAAAAAGAAAATACAGAGATCTGAAGTCCATCAAATAAAAGTTTCAGA
GACGAAAATTCTTTTTGTCATGAAATCATTTTTTACGTTAATGTAGGGAA
GAACTAAGGAAAATAATTTTGTAAATGTACAAAAAAAAAATTGTTCAAAA
TAAGGAGAGTTGATAATAGATAGAAAAAAAGTGAACTTT
Genomic location of TG109  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D324 marker 324
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)