SGN Marker CD37

SGN-M325

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1125
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
CD37 image not available
Forward sequence
GGGGCCTTTATTTACATTTTTCTTCTTGCTCCCTTGGGAAGATTTTGGAATATTATCATCAACATCCATCCCATCATTATCACTATCTTC
AGCACTGGAATCATTCTTGACACCATCTTCAAATTCTTGCACCAGCTCATTCAAATCCCACAATTTCAGTAAATGGTCATGTGATGCACT
TCCAAAATACTTTCTATCATGAAAAAAGGCAACACGTTCAACAGGGTATTCTGAGTGCTCGCCAATTGGCTGAA
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1497661.2e-1541 (16.1% of RFLP seq)+
SGN-U1497663.3e-1955 (21.7% of RFLP seq)+
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42942)
Chromosome
2
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43942
Forward primer (5'-3')
CATCAACATCCATCCCATCATT
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
AGCAACAAGTGGCGATGGGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8893)
Chromosome
2
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CD37 was used as an overgo probe on plate 16 [well C5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GGCAACACGTTCAACAGGGTATTC
B sequence
AATTGGCGAGCACTCAGAATACCC
AB sequence
GGCAACACGTTCAACAGGGTATTCTGAGTG
Marker sequence
GGGGCCTTTATTTACATTTTTCTTCTTGCTCCCTTGGGAAGATTTTGGAA
TATTATCATCAACATCCATCCCATCATTATCACTATCTTCAGCACTGGAA
TCATTCTTGACACCATCTTCAAATTCTTGCACCAGCTCATTCAAATCCCA
CAATTTCAGTAAATGGTCATGTGATGCACTTCCAAAATACTTTCTATCAT
GAAAAAAGGCAACACGTTCAACAGGGTATTCTGAGTGCTCGCCAATTGGC
TGAA
Genomic location of CD37  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D325 marker 325
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)