SGN Marker TG612

SGN-M326

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG612 image not available
Forward sequence
GAGACAGCTTGCATGCCTGCGAAGAAACTGATAATGTGCGAAGGAAAGAACAATACACGTGCTATAATTAAATCATTATGAATTTGCAGC
AAGTATTTTAAAGTAGCTATTCTCTACTAATTACAGAATAAAGGAGCATGTAAATGGTGCAATCACTGTAACTACTTATACCTGGAGATC
TAACACATATCTTTATTTGACAATATTCCGTTTGAAAGATAAGAAGAGTCACTCTACTTCATGTTACATCACCATTATAGAGAAAAATTA
TGCAATTTCCCTCTTCCTTTTGAAAACTTACTTTATAATGCTGAGTACAACATAAAAAAGGAAACACTTTTCGATCTATTGCGGACTTCG
AATTGATATTCTTGAAAAACCAATGCACCTACTGTCAGCGTGACACTTCGAAGGCTAGCAACAAGATGCTTGATCTTGAGCAAATGAACT
TCATAAGAACATAACTTTC
Reverse sequence
GGAGACATCCTTGCATGCCTGCAGAGAAACTGTTAATGTGCAAAGTAAAGAAAAATACACGTGCTAAAATTAAATCATTATGAATTTGCA
GCATGTATTTTAAAGTAACTATTCTCTACTAATTAAAGAAGAAAGGAGCATGTAAGTGGTGCAATCACTGTAACTACTTCTACCTGGTGA
TCTAACAAATATCTTTATTTGACAATATTCAGTTTGAAAGATAAGAAGAGTCACTCTACTTCATGTACATCACATTATAAAAAAAAATTA
TACAATTTCCCTCTTCCTTTTGAAAACTTACTTTATAATTCTGTGTAGAAGATTAGAAAGTAGACACTTTTCTAGCAATTTCAAACTTCA
AATTGATATTTTAAAAAACCAATGCACCTACTGCACACATGACACTTCAAATGCTAACAACAGTATGCTTGATCTTGAGTAAATGAACTT
AATAAGAACATAACTTTCCATCACACTAGTTATCATAGAACAATTATAACATATTAAATATATTATATAAAGATAACATATTCGCA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8895)
Chromosome
8
Position
16.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8894)
Chromosome
6
Position
1.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG612 was used as an overgo probe on plate 2 [well D6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TACTGTCAGCGTGACACTTCGAAG
B sequence
GCATCTTGTTGCTAGCCTTCGAAG
AB sequence
TACTGTCAGCGTGACACTTCGAAGGCTAGC
Marker sequence
GAGACAGCTTGCATGCCTGCGAAGAAACTGATAATGTGCGAAGGAAAGAA
CAATACACGTGCTATAATTAAATCATTATGAATTTGCAGCAAGTATTTTA
AAGTAGCTATTCTCTACTAATTACAGAATAAAGGAGCATGTAAATGGTGC
AATCACTGTAACTACTTATACCTGGAGATCTAACACATATCTTTATTTGA
CAATATTCCGTTTGAAAGATAAGAAGAGTCACTCTACTTCATGTTACATC
ACCATTATAGAGAAAAATTATGCAATTTCCCTCTTCCTTTTGAAAACTTA
CTTTATAATGCTGAGTACAACATAAAAAAGGAAACACTTTTCGATCTATT
GCGGACTTCGAATTGATATTCTTGAAAAACCAATGCACCTACTGTCAGCG
TGACACTTCGAAGGCTAGCAACAAGATGCTTGATCTTGAGCAAATGAACT
TCATAAGAACATAACTTTC
Genomic location of TG612  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D326 marker 326
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)