SGN Marker CT43

SGN-M3268

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42968)
Chromosome
7
Position
30.30 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43968
Forward primer (5'-3')
TTCAAGATTTCCACATTTACAGAC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
CAATGCCCAAGTCGTCTCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Eggplant-COSII   
Map version
63 (location: 42351)
Chromosome
7
Position
62.60 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXHIR 1997   
Map version
32 (location: 13171)
Chromosome
7
Position
26.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 13173)
Chromosome
7
Position
68.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 13172)
Chromosome
7
Position
36.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Genomic location of CT43  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3268 marker 3268
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)