SGN Marker ACC2

SGN-M3285

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42937)
Chromosome
1
Position
33.30 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43937
Forward primer (5'-3')
TACCTTCACCATACTACCCAGCGT
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GGTGGATGTTGTGTTGGTTGGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 1992   
Map version
28 (location: 13197)
Chromosome
1
Position
63.50 cM
Confidence
I(LOD2)
Protocol
unknown


Tomato-EXPEN 1992
Genomic location of ACC2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3285 marker 3285
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)