SGN Marker TG266

SGN-M33

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG266 image not available
Forward sequence
ACACTATAAACTATGTATCACTCAGTTATCTGCATAAGAACAATAAGCTCGACATAACTTATGCAGCGTCTGGTTGGCAGTATTTAACTG
TTCATTATAATATCCTCATGACTTATGCCAGAATTATGCGGGATAGATTATGATCTTTTGTTTGATTCTAGCATTTATCTTTGTTGAGCA
TTACACTCATTATCATGTTCTACAGCATG
Reverse sequence
CATGCTGTAGAACATGATAATGAGTGTAATGCTCAACAAAGATAAATGCTAGAATCAAACAAAAGATCATAATCTATCCCGCATAATTCT
GGCATAAGTCATGAGGATATTATAATGAACAGTTAAATACTGCCAACCAGACGCTGCATAAGTTATGTCGAGCTTATTGTTCTTATGCAG
ATAACTGAGTGATACATAGTT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1519706e-1141 (19.6% of RFLP seq)+
SGN-U1718493.8e-12111 (53.1% of RFLP seq)+
SGN-U1718497.2e-2674 (35.4% of RFLP seq)+
SGN-U1718161.8e-26111 (53.1% of RFLP seq)+
SGN-U1519705.7e-1141 (20.4% of RFLP seq)-
SGN-U1718493.7e-12111 (55.2% of RFLP seq)-
SGN-U1718496.9e-2674 (36.8% of RFLP seq)-
SGN-U1718161.7e-26111 (55.2% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53879)
Chromosome
2
Position
53.50 cM
Confidence
uncalculated
Protocol
RFLP

Dry_matter_weight_dmw2_1 Titratable_acidity_ta2_1 Eugenol_content_eug2_1 Fruit_weight_fw2_1Soluble_solid_content_ssc2_1 Sugar_content_suc2_1 3_Methylthio_propanal_content_mta2_1 Hex_3_en_1_ol_content__x3o2_1 Fruit_diameter_fd2_1 Color_a_a2_1 Dry_matter_weight_dmw2_2 Sugar_content_suc2_2 Soluble_solid_content_ssc2_2 Color_L_L2_1 Fruit_weight_fw2_2Titratable_acidity_ta2_2 Dry_matter_weight_dmw2_3 Color_b_b2_1Fruit_diameter_fd2_2 Elasticity_ela2_1 Carotene_content_car2_1 2_Isobutylthiazole_content_ibt2_1
Tomato QTL map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7812)
Chromosome
2
Position
69.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG266 was used as an overgo probe on plate 16 [well B12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P257K02,   P011J13,   P111P08,   P258H04,   P032N14,   P026F21,   P163F04,   P320N02,   P291P19,   P154P23,   P269J19,   P147J24,   P334E05,   P102G13,   P302L10

 Overgo Sequences

A sequence
TAAGCTCGACATAACTTATGCAGC
B sequence
ATACTGCCAACCAGACGCTGCATA
AB sequence
TAAGCTCGACATAACTTATGCAGCGTCTGG
Marker sequence
ACACTATAAACTATGTATCACTCAGTTATCTGCATAAGAACAATAAGCTC
GACATAACTTATGCAGCGTCTGGTTGGCAGTATTTAACTGTTCATTATAA
TATCCTCATGACTTATGCCAGAATTATGCGGGATAGATTATGATCTTTTG
TTTGATTCTAGCATTTATCTTTGTTGAGCATTACACTCATTATCATGTTC
TACAGCATG
Genomic location of TG266  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D33 marker 33
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)