SGN Marker TG544

SGN-M331

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG544 image not available
Forward sequence
CAAACAGCTCCCGCCCAACAAAAGGCTGCAAAAGTTCAACATTAGAAAAAAAGAAAGACAACTAGAAGCACTTCTATATTTCTGGAATTT
CCTCTTTTTAGAAAGTCTTTTAGCTTTTGTTTTTTTCTTAAGAACAATGAAAAAGAGGTTTTCTATTTATTTATTTTTGAGATAAAAGGT
ATCTGATGAGGAAGAGGATGTTGAAGAGGGTAATACCTGTAGTTGAGCCAGTCTTGCACATGTTCTTAATGCTGGACTAGGTGATTCTTT
CAAAAGTTCAATGCTGAAATGTCTCATCCACTCTGCCCAATCCTCTTTAGTACTCCGTTGAGAAGCCTCACCAGCGGTACGCAATCTGCC
ATCATTGACCTACATAAATGTATTTTAGAGTCTATATTCCCAATTCAACATCGTCAAAATTTGAAGAAAAGTAACAGAAAAATTATTCAA
ATAGAAGGGAGAAATAGAAACAAAAATTCAATAATTCCTGCTACAACTCAAAGT
Reverse sequence
TGCATTGATTTTTGGGGTTCTCCCTGTCACTACTATAACATTATAAAGGCTTAAAGTTATACTGCTGGGGATTTGTTATTGATACGATTA
ATTTTTCATATACAGCACAAGGAATTTGAAGAGATCCAGGGACGAGTGGAAAAACGCGAGCCACTGATTTTTGGGAGCACCACAGCTCAG
AGATTAAATCGGCGGCTGCCGGTTGAGGTCATCAGTGATCCTTTAAGTGATGGAGAGAGTGACCTCTATGAGGTTGGGACCGACATGCAG
AAGCAGCTCAGAAACCATCAGGTAATTTTTTAGTCTTCTTTTGTTTGTGATACACTGGGACTTAAAATTGTTGTACTTGATGGTAGGGAT
GAAATCCTTTCTGACTACCTTCAGTCGTTTAGCACTCTCATAAGTCATAACTAACTATAATAGCACCATCACCCAAAACGAAAGAACCCC
ACCCCCACCCCACCCCAAAAAAAAAAGAAGAAGAAGAAGAAGAGGGGAAGTAATTGTTCATAGCTCT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8904)
Chromosome
1
Position
113.70 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG544 was used as an overgo probe on plate 5 [well E1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P028O12,   P302D12,   P054M02,   P329D16,   P250G09,   P079E19,   P260G11,   P194P23,   P231B04,   P173N03,   P224C13,   P190M08,   P079D13,   P297G15,   P292P07,   P145N14,   P257J16,   P302D11,   P093M08,   P015L19

 Overgo Sequences

A sequence
GAGGATGTTGAAGAGGGTAATACC
B sequence
GACTGGCTCAACTACAGGTATTAC
AB sequence
GAGGATGTTGAAGAGGGTAATACCTGTAGT
Marker sequence
CAAACAGCTCCCGCCCAACAAAAGGCTGCAAAAGTTCAACATTAGAAAAA
AAGAAAGACAACTAGAAGCACTTCTATATTTCTGGAATTTCCTCTTTTTA
GAAAGTCTTTTAGCTTTTGTTTTTTTCTTAAGAACAATGAAAAAGAGGTT
TTCTATTTATTTATTTTTGAGATAAAAGGTATCTGATGAGGAAGAGGATG
TTGAAGAGGGTAATACCTGTAGTTGAGCCAGTCTTGCACATGTTCTTAAT
GCTGGACTAGGTGATTCTTTCAAAAGTTCAATGCTGAAATGTCTCATCCA
CTCTGCCCAATCCTCTTTAGTACTCCGTTGAGAAGCCTCACCAGCGGTAC
GCAATCTGCCATCATTGACCTACATAAATGTATTTTAGAGTCTATATTCC
CAATTCAACATCGTCAAAATTTGAAGAAAAGTAACAGAAAAATTATTCAA
ATAGAAGGGAGAAATAGAAACAAAAATTCAATAATTCCTGCTACAACTCA
AAGT
Genomic location of TG544  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D331 marker 331
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)