SGN Marker TG618

SGN-M332

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GGAGACAGCTTGCATGCCTGCAGAACACATACAGCAACAACTTTTTCAGTTTTTATTTTACAACAAAAACATTAAAACAGATGTAGGTAA
TTGATTGCAAAGTTTCCACCTACCAGACACAGAAATAGAAGGCTCTTCTTTCCTAAAGTAATAAACCTGCTCAAAATGATAAAGCATGGA
TAGATAGTGTTTCCGCAAGACAAATGAAGCATTGGTCACAGAAGATGGAAATCTGAATATTCCTTTCACCTCCCCCCATTTTCTCTCTCT
AATAACCTGCACCAAGTTCACAATACAGAAACTGAGTGAATACAAATCACATTACAGCAACCATTTTAAGGGTGAAACAAAATTATTTTG
GGCTTGATAAGAAAAAGGAAGTGTAAATTTGAGAATGTCAGACCAGAAATAAATTCACTGAATCAAGTTTGAGAAAATCATCTGACGCAG
GTCATGAGCACTTGAACAAGAATAAATCAAAGGTAATACAAACCAAAACAAGTAGGTGACATCAGCTGATGCATTCTTAATTC
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGAACACATACAGCAACAACTTTTTCAGTTTTTATTTTACAACAAAAACATTAAAACAGATGTAGGTAA
TTGATTGCAAAGTTTCCACCTACCAGACACAGAAATAGAAGGCTCTTCTTTCCTAAAGTAATAAACCTGCTCAAAATGATAAAGCATGGA
TAGATAGTGTTTCCGCAAGACAAATGAAGCATTGGTCACAGAAGATGGAAATCTGAATATTCCTTTCACCTCCCCCCATTTTCTCTCTCT
AATAACCTGCACCAAGTTCACAATACAGAAACTGAGTGAATACAAATCACATTACAGCAACCATTTTAAGGGTGAAACAAAATTATTTTG
GGCTTGATAAGAAAAAGGAAGTGTAAATTTGAGAATGTCAAACCAGAAATAAATTCACTGAATCAAGTTTGAGAAAATCATCTGACGCAG
GTCATGAGCACTTGAACAAGAATAAATCAAAGGTAATACAAACCAAAACAAGTAGGTGACATCAGCTGATGCATTCTTAATTCTTGT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1506612.7e-89165 (31.0% of RFLP seq)+
SGN-U1506612.7e-89165 (30.7% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53576)
Chromosome
12
Position
31.29 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53366)
Chromosome
12
Position
43.11 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40113)
Chromosome
12
Position
55.30 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8905)
Chromosome
12
Position
41.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG618 was used as an overgo probe on plate 6 [well F3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAGACAGCTTGCATGCCTGCAGAA
B sequence
GTTGTTGCTGTATGTGTTCTGCAG
AB sequence
GAGACAGCTTGCATGCCTGCAGAACACATA
Marker sequence
GGAGACAGCTTGCATGCCTGCAGAACACATACAGCAACAACTTTTTCAGT
TTTTATTTTACAACAAAAACATTAAAACAGATGTAGGTAATTGATTGCAA
AGTTTCCACCTACCAGACACAGAAATAGAAGGCTCTTCTTTCCTAAAGTA
ATAAACCTGCTCAAAATGATAAAGCATGGATAGATAGTGTTTCCGCAAGA
CAAATGAAGCATTGGTCACAGAAGATGGAAATCTGAATATTCCTTTCACC
TCCCCCCATTTTCTCTCTCTAATAACCTGCACCAAGTTCACAATACAGAA
ACTGAGTGAATACAAATCACATTACAGCAACCATTTTAAGGGTGAAACAA
AATTATTTTGGGCTTGATAAGAAAAAGGAAGTGTAAATTTGAGAATGTCA
GACCAGAAATAAATTCACTGAATCAAGTTTGAGAAAATCATCTGACGCAG
GTCATGAGCACTTGAACAAGAATAAATCAAAGGTAATACAAACCAAAACA
AGTAGGTGACATCAGCTGATGCATTCTTAATTC
Genomic location of TG618  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D332 marker 332
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)