SGN Marker CD73

SGN-M3349

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42944)
Chromosome
3
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43944
Forward primer (5'-3')
CGGGTTCCAATTCGGTCCAG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
CGACGGCGACACTTCATTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 1992   
Map version
28 (location: 13290)
Chromosome
3
Position
14.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Genomic location of CD73  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3349 marker 3349
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)