SGN Marker TG25

SGN-M335

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2400
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TGCATTTGTTTGACACATTCTTTGTGAAAATCCGCTTGTGTCAACATAATAGAGTATACTGAATTTGGTAAAACTAAACCGTCTTTTGCA
CCAAATAATTGGGCACTGCCGTATATTCTTTCTAGAATTTATCTGCATAGTTTGATGCGATTGTTTTGTAAAAGATTTGATCTAATTTCT
CTTTGAACTTGGAAATCTGATACGGTATTATTTGTCATAATTTCTATTTTTAGAGTCGAAATTATAAAAACTTGACTAATATTTTAAGAT
GTATTTTTTTATCATATTGATGTGCAAGAAATTGAAATTTATAATACTTTTCATATAGGTTTTAAAATATCTAATTTGATCTTCAAAAAT
TAGTTAAATTGACTTTCGATAAACACAACGATGACGAACAAGTCCGGATAGAGGAAGTATCTTACACCGTTGGAGGATGACATATCAAAA
GGAGCGGATATATTAGCTTTTAAATGTGAGCTTTAACCTGTCATATTTTTCTAAACTGTTAAGTGTCACCTAATCATATGCAATAAAAAT
TGTGTATTTCATGATTACTTTTTCTTTATC
Reverse sequence
TTTGCATTTGTTTGACACATTCTTTGTGAAATCCGCTTGTGTACAACATAATAGAGTATACTGAATTTGGTAAACTAAACCGTCTTTTGC
ACCAAATAATTTGGCACTGCCGTATATTCTTTCTAGAATTTATCTGCATAGTTTGATGCGATTGTTTTGTAAAAGATTTGATCTAATTTC
TCTTTGAACTTGGAAATCTGATACGGTATTATTTGTCATAATTTCTATTTTTAGAGTCAAATTATAAAAACTTGACTAATATTTTAAGAT
GTATTTTTTTATCATATTGATATGCAAAAAATTGAAATTTATAATACTTTTCATATAGTTTTAAAATATCTAATTTATCTTCAAAAATTA
GTTAAATTGGACTTTCGATANACACAACATGAACAAACAAATCCCGGATAGAGTAAGTATCTTACACCGTTGGAAGATGACATAGCAAAA
GGAGTGGATATATTAGCCTTTAAATGTGGAGCTTTAACCTGTCATATTTTTCTAAACTGTTAATTGTCACATAATAATATGCAATAAAAA
TTGTGTATTTAATGTTTACTTT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1493631.1e-11128 (22.5% of RFLP seq)+
SGN-U1543323.6e-3379 (13.9% of RFLP seq)+
SGN-U1668994e-0528 (5.0% of RFLP seq)-
SGN-U1668994e-0528 (5.0% of RFLP seq)-
SGN-U1484584e-0532 (5.7% of RFLP seq)-
SGN-U1475801.6e-0752 (9.3% of RFLP seq)-
SGN-U1439231.6e-0789 (15.8% of RFLP seq)-
SGN-U1517464.1e-0841 (7.3% of RFLP seq)-
SGN-U1686456.7e-1044 (7.8% of RFLP seq)-
SGN-U1645931.7e-1057 (10.1% of RFLP seq)-
SGN-U1493638.1e-25126 (22.4% of RFLP seq)-
SGN-U1543328.7e-3175 (13.3% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53234)
Chromosome
6
Position
27.69 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_6 MQTL_1_Maturity_6 MQTL_2_Late_blight_6 MQTL_2_Maturity_6
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39962)
Chromosome
6
Position
38.60 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8915)
Chromosome
6
Position
31.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8918)
Chromosome
6
Position
16.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG25 was used as an overgo probe on plate 2 [well E12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GATGACGAACAAGTCCGGATAGAG
B sequence
CGGTGTAAGATACTTCCTCTATCC
AB sequence
GATGACGAACAAGTCCGGATAGAGGAAGTA
Marker sequence
TGCATTTGTTTGACACATTCTTTGTGAAAATCCGCTTGTGTCAACATAAT
AGAGTATACTGAATTTGGTAAAACTAAACCGTCTTTTGCACCAAATAATT
GGGCACTGCCGTATATTCTTTCTAGAATTTATCTGCATAGTTTGATGCGA
TTGTTTTGTAAAAGATTTGATCTAATTTCTCTTTGAACTTGGAAATCTGA
TACGGTATTATTTGTCATAATTTCTATTTTTAGAGTCGAAATTATAAAAA
CTTGACTAATATTTTAAGATGTATTTTTTTATCATATTGATGTGCAAGAA
ATTGAAATTTATAATACTTTTCATATAGGTTTTAAAATATCTAATTTGAT
CTTCAAAAATTAGTTAAATTGACTTTCGATAAACACAACGATGACGAACA
AGTCCGGATAGAGGAAGTATCTTACACCGTTGGAGGATGACATATCAAAA
GGAGCGGATATATTAGCTTTTAAATGTGAGCTTTAACCTGTCATATTTTT
CTAAACTGTTAAGTGTCACCTAATCATATGCAATAAAAATTGTGTATTTC
ATGATTACTTTTTCTTTATC
Genomic location of TG25  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D335 marker 335
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)