SGN Marker CT25

SGN-M337

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
900
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT25 image not available
Forward sequence
CTTTTTTTTTTTTTTTAAGTATATCTCAGTGTGGGTTTTTTTCTTCTTTTTGTCGATCAAATCGATATTTGTATAAACCCCAAAGAATCA
TCTGAAGCATCAATCAGCCATGACGCTTGGTTCAGGAGGATCTAGTGTTGTGGTCCCTCGCAATTTCAGATTACTGGAGGAACTTGAACG
CGGGGAGAAGGGTATTGGAGATGGGACAGTGAGCTATGGTATGGATGATGGAGATGATATTTATATGCGTTCTTGGACTGGCACCATTAT
TGGTCCTCACAATTCTGTGCATGAAGGCCGTATTTATCAGTTGAAGCTATTTTGCGACAAGGATTATCCGGAGAAGCCACCAAGTGTGCG
TTTCCACTCTCGAGTTAACATGACATGTGTCAACCATGAGACAGGAGTGGGGGAGCCAAAAAAGTTTGCTTTGCTTGCAAATTGGCAGCG
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1434051.3e-07200 (44.4% of RFLP seq)+
SGN-U1612154.6e-3598 (21.8% of RFLP seq)+
SGN-U1612149e-52123 (27.3% of RFLP seq)+
SGN-U1446961e-127341 (75.8% of RFLP seq)+
SGN-U144697430 (95.6% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8924)
Chromosome
1
Position
8.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT25 was used as an overgo probe on plate 3 [well H4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P150N18,   P121F13,   P186P07,   P197N11,   P026M03,   P258G23

 Overgo Sequences

A sequence
GGTTCAGGAGGATCTAGTGTTGTG
B sequence
TGAAATTGCGAGGGACCACAACAC
AB sequence
GGTTCAGGAGGATCTAGTGTTGTGGTCCCT
Marker sequence
CTTTTTTTTTTTTTTTAAGTATATCTCAGTGTGGGTTTTTTTCTTCTTTT
TGTCGATCAAATCGATATTTGTATAAACCCCAAAGAATCATCTGAAGCAT
CAATCAGCCATGACGCTTGGTTCAGGAGGATCTAGTGTTGTGGTCCCTCG
CAATTTCAGATTACTGGAGGAACTTGAACGCGGGGAGAAGGGTATTGGAG
ATGGGACAGTGAGCTATGGTATGGATGATGGAGATGATATTTATATGCGT
TCTTGGACTGGCACCATTATTGGTCCTCACAATTCTGTGCATGAAGGCCG
TATTTATCAGTTGAAGCTATTTTGCGACAAGGATTATCCGGAGAAGCCAC
CAAGTGTGCGTTTCCACTCTCGAGTTAACATGACATGTGTCAACCATGAG
ACAGGAGTGGGGGAGCCAAAAAAGTTTGCTTTGCTTGCAAATTGGCAGCG
Genomic location of CT25  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D337 marker 337
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)