SGN Marker TG475

SGN-M338

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
900
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TCGCTCTACTCCCCCAATTTGAACTCTCTATCGGTGATCTCTTTCTCCGGCGAAGTATTTCGGTAAGTTTCTTATCTCATCTCTTATGTT
TTCTTCTTCCGTTCATTTCACATTTGAAAAACCCTAACCCCTTTTTTGATTGCGAGTTCAAAGCACCAACTTCGATGTAGGTTTTACAAT
GTTTTTTTTTTTTTTGAATTCTTCATGTTCATTGTGTTGTGATATTGGATATTAAGTTTAATCATAAGGTGAGGTGCCGGAGTCTTCGTA
GTTTGTTTAAGAGATCTGTATTAGAGTAATCTTAGCGACTGTAAATAAAGTGGGTATATTGGGAAATTCATAGGGAAATTGGATTCGTTC
AGGATTGAGGTGTTATTGTTGTTGTTCACTGTAATAATAAGGGAAAAAAAGTGAAAGGGGTGTAAAAGATGGAAACTTTATCACTTTCCA
GGAATTGTGGTGTAAAGTTTAGTTAATGGGGTTCAATTTGAA
Reverse sequence
GGGAGACAAGCTTGCATGCCTGCAGAAATTGAAGCTCCAATATGCAGCACAAACCAACACATTTCACAAAGAACTGTAAAACCCAACTGC
TGAAAAGTAACAATTTGATAACAAAAACATTGAATGATGATGAAAATTCCATCTTTTACACCAATTCCACTTTTTCCCTTCGTTATATAA
GAGTATAACAACAATAACTCCTCAATCCTAAACTAATTGAATTGCCCTTACAAATTTTTAACCTGAGTTTTAGCTCCATCACACGTAACA
GACCTAATGTAAGCCACAAGTATACCTCTAGACTCCAAGCATCAAGTAAAAATTAAAGCCCAAGCGCTTAAAAGTCGCAAATGATCATAT
AGACAATTGACTTAGGCAGACATCATATTTACAAGCTCATAAGATTCTTCAAATTGAACCCCATTAACTAAACTTTACACCACAATTCCT
GGAAAGTGATAAAGTTTCCATCTTTTACACCCCTTTCACTTTTTTTCCCTTATCATTACAGTGAACAACAACA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1614376.3e-1646 (9.3% of RFLP seq)+
SGN-U1452531.8e-2863 (12.8% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8925)
Chromosome
5
Position
42.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG475 was used as an overgo probe on plate 14 [well H1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P223D23,   P281J06,   P015O20,   P160F21

 Overgo Sequences

A sequence
TCTCTATCGGTGATCTCTTTCTCC
B sequence
ACCGAAATACTTCGCCGGAGAAAG
AB sequence
TCTCTATCGGTGATCTCTTTCTCCGGCGAA
Marker sequence
TCGCTCTACTCCCCCAATTTGAACTCTCTATCGGTGATCTCTTTCTCCGG
CGAAGTATTTCGGTAAGTTTCTTATCTCATCTCTTATGTTTTCTTCTTCC
GTTCATTTCACATTTGAAAAACCCTAACCCCTTTTTTGATTGCGAGTTCA
AAGCACCAACTTCGATGTAGGTTTTACAATGTTTTTTTTTTTTTTGAATT
CTTCATGTTCATTGTGTTGTGATATTGGATATTAAGTTTAATCATAAGGT
GAGGTGCCGGAGTCTTCGTAGTTTGTTTAAGAGATCTGTATTAGAGTAAT
CTTAGCGACTGTAAATAAAGTGGGTATATTGGGAAATTCATAGGGAAATT
GGATTCGTTCAGGATTGAGGTGTTATTGTTGTTGTTCACTGTAATAATAA
GGGAAAAAAAGTGAAAGGGGTGTAAAAGATGGAAACTTTATCACTTTCCA
GGAATTGTGGTGTAAAGTTTAGTTAATGGGGTTCAATTTGAA
Genomic location of TG475  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D338 marker 338
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)